Stem Cells, Vol. 14, No. 5, 592-602,
September 1996
© 1996 AlphaMed Press
Synergistic Effects of Hepatocyte Growth Factor on Human Cord Blood CD34+ Progenitor Cells are the Result of c-met Receptor Expression
Julie P. Goffa,
Donna S. Shieldsa,
Bryon E. Petersenb,
Valerie F. Zajacb,
George K. Michalopoulosb,
Joel S. Greenbergera
a Departments of Radiation Oncology and
b Pathology, University of Pittsburgh and University of Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania, USA
Key Words. . Hepatocyte growth factor • Interleukin 11 • Umbilical cord blood • CD34+ cells • Synergy
Correspondence: Dr. Joel S. Greenberger, Department of Radiation Oncology, University of Pittsburgh, Presbyterian Hospital, 200 Lothrop Street, Pittsburgh, PA 15213, USA.
 |
Abstract
|
|---|
Hepatocyte growth factor (HGF) is a pleiotropic growth factor which, in addition to its mitogenic potency for primary hepatocytes, also has a role in the regulation of cell motility, cell growth and morphogenesis. In the present study, we show that c-met, the high-affinity receptor for HGF, is expressed on human cord blood (CB) CD34+ progenitor cells and CD34+Thy-1+ Lin (lin) cells. We have investigated the capacity of HGF to synergize with other growth factors to induce colony formation by CB CD34+ progenitor cells. CD34+ cells were cultured in semisolid medium containing serum with increasing concentrations of GM-CSF, G-CSF, macrophage colony-stimulating factor (M-CSF), stem cell factor (SCF), interleukin 3 (IL-3) and IL-11 alone or in combination with HGF. HGF acted as a potent synergist and enhanced, up to fourfold, colony formation induced by GM-CSF, G-CSF or M-CSF. HGF in combination with SCF, IL-3 or IL-11 did not induce proliferation of colony forming units-granulocyte macrophage (CFU-GM) above control levels. In serum-deprived cultures, HGF was only detectably synergistic with IL-11, and all other culture combinations showed no proliferation. To determine whether the stimulatory effect of IL-11 and the synergistic effect of HGF in the absence of serum could be attributed to the effect of these two cytokines on stem cells, IL-11-stimulated and unstimulated lin cells were analyzed for expression of c-met. CD34+Thy-1+Lin cells were positive for c-met, both in the presence and absence of IL-11 stimulation, and Northern analysis indicated that c-met RNA expression was upregulated in response to IL-11 compared to unstimulated controls. These results provide strong evidence for upregulation of the HGF receptor on primitive hematopoietic cells by IL-11, and for the synergistic role of HGF in colony formation by hematopoietic stem cells.
 |
Introduction
|
|---|
A large number of hematopoietic growth factors are known to influence both the proliferation and differentiation of hematopoietic progenitor cells. The generation of colonies in semisolid medium is dependent upon the stimulation by these growth factors. GM-CSF, macrophage colony-stimulating factor (M-CSF), G-CSF and interleukin 3 (IL-3) promote the formation of colony-forming unit (CFU)-GM from CD34+ hematopoietic progenitor cells, and the cell phenotypes on which they act have been shown to overlap [1, 2]. In particular, stem cell factor (SCF), also known as kit-ligand or mast cell growth factor, affects a more immature population of CD34+ cells [3] enabling them to respond to other hematopoietic growth factors. Another cytokine, IL-11, is similar to SCF in its blast cell growth factor activity and can synergize with other growth factors to shorten the G0 period of the cell cycle of early hematopoietic progenitors [4, 5].
Hepatocyte growth factor (HGF) is a 100 kDa pleiotropic growth factor originally isolated from rat platelets [6, 7] with many distinct effects on cells in culture. In addition to its mitogenic potency for primary hepatocytes, HGF has also been shown to have a role in the regulation of cell motility, cell growth, morphogenesis, angiogenesis and cytotoxicity in a wide variety of cell types other than hepatocytes [8-12]. The c-met proto-oncogene product, a member of the tyrosine kinase family, is the high-affinity receptor for HGF [13-16] and mediates all the known effects of HGF. The c-met gene is expressed in a variety of cell types and tissues, primarily in cells or tumors of epithelial origin [17-19]. Although one of the primary targets of HGF is epithelial cells, many nonepithelial cell types such as skeletal muscle, lymphoid and hematopoeitic cells also respond to HGF [20-23].
It has recently been shown that the c-met receptor is expressed in human bone marrow and peripheral blood hematopoietic progenitor cells and several murine hematopoietic cell lines [24, 25], and that HGF acts to stimulate colony formation by human or murine hematopoietic progenitor cells [24, 25]. HGF has been shown to be produced by HL-60 cells [26, 27]. HGF mRNA is expressed in stromal cells such as endothelial cells, fibroblasts, smooth muscle cells and macrophages [21, 28], and HGF binds to the extracellular matrix in liver [29]. Nishino et al. [27] demonstrated that HGF and c-met mRNA were coexpressed in the adherent layer of long-term cultures of murine fetal liver and adult bone marrow.
In the present study, we examined the effects of HGF alone or in combination with other growth factors on the in vitro generation of CFU-GM from CD34+ human umbilical cord blood hematopoietic progenitor cells. The results show a new synergy between IL-11 and HGF based upon the ability of IL-11 to upregulate the c-met receptor for HGF.
 |
Materials and Methods
|
|---|
Cell Preparation
Human umbilical cord blood (CB) was collected immediately after delivery in accordance with institutional guidelines, and placed in 50 ml tubes containing ACD-A (Cytosol Labs; Braintree, MA). The CB was diluted with Ca2+ and Mg2+ free phosphate-buffered saline (PBS), and low-density mononuclear cells were isolated by Ficoll-Paque (1.077 g/ml) density gradient centrifugation (Pharmacia Biochem; Piscataway, NJ). CB mononuclear cells were washed twice in PBS and then resuspended in PBS + 5 mM EDTA, 0.5% bovine serum albumin (BSA) for magnetic labeling and separation. CD34+ progenitor cells were isolated by immunomagnetic selection techniques, as previously described [30]. Briefly, cells were incubated with blocking reagent (human IgG) and QBEND/10 CD34 antibody for 15 min at 4°C, then washed in PBS plus 5mM EDTA, 0.5% BSA followed by incubation with a secondary antibody-magnetic microbead conjugate for an additional 15 min at 4°C. The unlabeled fraction of CD34 cells was separated from the labeled CD34+ fraction on a high-gradient magnetic separation column (Miltenyi Biotec; Sunnyvale, CA). The percentage of CD34+ cells was determined by flow cytometric analysis.
Flow Cytometry
CD34+ cells were first purified by immunomagnetic selection, then labeled with a mixture of fluorescein isothiocyanate (FITC)-conjugated anti-CD34 (HPCA-2) (Becton Dickinson; San Jose, CA), Thy-1(anti-CDw90) (Pharmingen; San Diego, CA) and phycoerythrin (PE)-conjugated anti-CD3, CD11b, CD19, CD33, CD56 and HLA-DR antibodies (Becton Dickinson) and glycophorin A (Dako Corp.; Carpenteria, CA). FITC and PE isotype-matched mouse IgG1 and IgG2a were used as controls. Cells were sorted using a Becton Dickinson FACStar Plus flow cytometer into two populations; CD34+Thy-1+Lin (lin) (candidate stem cells) and CD34+Thy-1+Lin+ (lin+).
Hematopoietic Growth Factors
The purified recombinant human growth factors used included GM-CSF, G-CSF, M-CSF, SCF, IL-11, IL-3 and erythropoietin (Epo) (R&D Systems; Minneapolis, MN, Stem Cell Technologies, Inc.; Vancouver BC, PeproTech, Inc.; Rocky Hill, NJ), and HGF (supplied by Dr. G.K. Michalopoulos).
Colony Assay
For each experiment, 2 x 103 CD34+ cells were plated in duplicate in semisolid medium consisting of Iscove's modified Dulbecco's medium (IMDM) containing 0.9% methylcellulose, 30% fetal bovine serum, 1% BSA and 104 M 2-mercaptoethanol with increasing concentrations (0.1-1000 ng/ml) of the following cytokines: HGF, GM-CSF, G-CSF, M-CSF, SCF, IL-3 and IL-11 alone or in combination with various concentrations of HGF (1-100 pg/ml). Protein-deprived cultures consisted of IMDM and 0.9% methylcellulose, with the same cytokine concentrations as above. Cells (1 x 103) were also plated in the same medium with the addition of 5% PHA-LCM + 3 U/ml Epo, or 500 cells/well in the combination of SCF (50 ng/ml), GM-CSF (10 ng/ml), IL-3 (10 ng/ml) and Epo (3U/ml) (Stem Cell Technologies, Inc.). Colony growth (CFU-GM, BFU-E, CFU-granulocyte, erythroid, macrophage, megakaryocyte (GEMM)) was scored after 14 days incubation at 37°C, 5% CO2. Colonies were defined as aggregates of greater than 40 cells. CFU-GM colonies contained granulocytes and macrophages. BFU-E colonies were defined as those with three or more clusters of hemoglobinized cells (erythroblasts). CFU-GEMM colonies were defined as multilineage colonies containing at least granulocytes and erythroid cells.
Statistics
Statistical significance was evaluated using the Student's t-test.
Northern Analysis
Total RNA was extracted from either unstimulated or IL-11-stimulated (100 ng/ml, 37°C overnight) CD34+ cells using the Qiagen RNeasy Kit. Pooled extracts of 20 µg of total RNA derived for each culture condition were then electrophoresed in a 1% agarose/formaldehyde gel. Total RNA was screened for mRNA expression. Once adequate separation of the 28s and 18s bands occurred, gels were denatured in 10 x standard saline citrate (SSC) for 30 min (2 x 15 min each). RNA was transferred to a synthetic membrane (GeneScreen Plus, DuPont NEN; Boston, MA) via capillary action overnight. A Stratagene crosslinker was used to crosslink the RNA to the filter. Prehybridization mixture containing nonspecific DNA was next added to the membrane in a hybridization tube and allowed to prehybridize for 2 h at 65°C. The prehybridization solution was replaced with fresh hybridization solution containing a radioactive cDNA probe and allowed to incubate overnight at 65°C in a hybridization oven. The membranes were washed in high-stringency conditions to remove any nonspecific binding of the radioactive probe. The stringency of the wash ranged from low stringency 2 x SSC at room temperature, to high stringency 0.1 x SSC, 0.5% SDS at 65°C (2 x 15 min each). Next, the filters were exposed to x-ray film (Kodak; Rochester, NY) at 80°C for a suitable period of time. The film was developed and each autoradiogram analyzed with the SI personal densitometer and Image QuaNT system (Molecular Dynamics; Sunnyvale, CA) to determine the relative amounts of RNA in each labeled band. The values measured were compared with control lanes to determine any significant increase or decrease in band intensity. To account for differences in loading, a GAPDH (glyceraldehyde-3-phosphate dehydrogenase) probe was used as an internal control, and each experimental sample was compared relative to the control.
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted from either IL-11-stimulated (100 ng/ml, 37°C overnight) or unstimulated CB CD34+ cells. In separate experiments, total RNA was extracted from lin- and lin+ cells stimulated with IL-11 before or following sorting. For each reaction, total RNA was reverse-transcribed to cDNA by using the Gene-Amp preamplification system (Perkin Elmer Cetus; Norwalk, CT.) The resulting cDNA was then subjected to 40 cycles of PCR using a DNA Thermal Cycler 480, "AmpliTaq" DNA polymerase (Perkin Elmer Cetus) and primer specific for c-met and actin. The c-met specific primers consisted of a forward primer of 'GCAGAAACCCCCATCCAGAATGTC3' and a reverse primer 5'GGCCCCTGGTTTACTGACATACGC3' giving a fragment of 836 base pairs in length. Human ß actin primers purchased from Clontech Laboratories (Palo Alto, CA) were expected to give a fragment of approximately 1,000 base pairs in length. The resulting products were run on 1% TRIS, boric acid, EDTA (TBE) agarose/ethidium bromide gel at 100V. The resulting gel was photographed with UV illumination.
Immunocytochemistry
Qualitative staining for c-met on cytocentrifuged cell preparations was performed as follows. IL-11-stimulated and unstimulated CD34+, lin and lin+ cells were cytocentrifuged onto glass slides, acetone-fixed and air-dried. Slides were rehydrated in deionized water and 10% goat serum in 1% BSA/PBS was applied as a blocking reagent for 10 min at room temperature. Following washing twice in PBS, the cells were incubated with c-met primary antibody (Santa Cruz Biotech, Inc.; Santa Cruz, CA) at a 1:50 dilution for 30 min at room temperature in a humidified chamber. For negative controls, cytocentrifuged preparations were incubated with an isotype-matched irrelevant antibody and the negative control liver sections were incubated with c-met blocking peptide (Santa Cruz Biotech, Inc.) The slides were then rinsed with PBS and incubated with goat antirabbit secondary antibody, 1:200 dilution (Vector Laboratories; Burlingame, CA) 30 min in a humidified chamber. For detection of c-met-positive cells, a peroxidase diaminobenzidine (DAB) colorimetric system was used according to the manufacturer's instructions (Vectastain ABC kit-Elite; Vector Laboratories). The slides were then counterstained using Shannon Hematoxylin, rinsed in PBS, dehydrated in ethanol and xylene and coverslipped using Cytoseal (Stephens Scientific; Riverdale, NJ). For morphological evaluation, slides were stained with Wright-Giemsa.
 |
Results
|
|---|
HGF Enhances GM-CSF, G-CSF and M-CSF-Induced Colony Formation by Human CB CD34+ Progenitor Cells Grown in Serum
The effects of HGF on the in vitro growth of CFU-GM from human CB CD34+ progenitor cells were first examined. The effects of colony formation in serum-supplemented cultures of GM-CSF, G-CSF and M-CSF (Fig. 1
) and IL-3, IL-11 and SCF (Fig. 2
) alone or in combination with 1, 10 or 100 pg/ml of HGF, are shown. GM-CSF, G-CSF, M-CSF, IL-3 and SCF each acted alone to increase CFU-GM colony numbers in a direct dose-response relationship. Cultures supplemented with IL-3, IL-11 or SCF alone (Fig. 2B
) gave rise to few colonies, but not significantly above the control level. Although HGF alone did not induce detectable proliferation of CD34+ progenitor cells (data not shown), at low concentrations (1 pg-100 pg), it synergized to increase the number of CFU-GM colonies induced by GM-CSF (up to 3.5-fold, p < 0.01), G-CSF (up to 4.8-fold, p < 0.01) and M-CSF (up to 4.6-fold, p < 0.01) (Fig. 1A-C
).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1. Effect of HGF on formation of CFU-GM from CB CD34+ cells stimulated by different recombinant CSFs. The effect of GM-CSF (A), G-CSF (B), and M-CSF (C) alone or in combination with HGF at a concentration of 1, 10 or 100 pg. The results of three experiments are presented as the mean and SE of the number of CFU-GM colonies per 2 x 103 cells plated scored on day 14.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Figure 2. Effect of HGF on formation of colonies by CB CD34+ cells in the presence of IL-3, IL-11 or SCF. The effect of IL-3 (A), IL-11 (B), or SCF (C) alone or in combination with HGF at a concentration of 1, 10 or 100 pg. The results of three experiments are presented as the mean and SE of the number of CFU-GM colonies per 2 x 103 cells plated scored on day 14.
|
|
In contrast, HGF was not synergistic with IL-3, IL-11 or SCF, and did not induce detectable proliferation of CFU-GM above the control levels (p > 0.1) (Fig. 2A-C
). HGF was not synergistic in cultures supplemented with conditioned medium or combinations of growth factors. When cultures were supplemented with PHA-LCM + Epo or the combination of GM-CSF, IL-3, SCF and Epo, the addition of HGF did not further increase the number of colonies derived from CFU-GM, BFU-E and CFU-GEMM (p > 0.1) (Figs. 3A and B
).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3. Effect of HGF on colony formation by CB CD34+ cells stimulated by mixtures of growth factors. A) The effect of PHA-LCM + Epo alone or in combination with 1, 10, 100 pg or 1 ng of HGF on colony formation (CFU-GM, BFU-E and CFU-GEMM) from CB CD34+ cells (1 x 103 cells/well). B) HGF is not synergistic with the combination of IL-3, GM-CSF, SCF and Epo. The effect of the combination of IL-3 (10 ng/ml), GM-CSF (10 ng/ml), SCF (50 ng/ml) and Epo (3 U/ml) and IL-3, GM-CSF, SCF, and Epo in combination with 1, 10, 100 pg or 1 ng of HGF on colony formation (CFU-GM, BFU-E and CFU-GEMM) from CB CD34+ cells (500 cells/well). The results of three experiments are presented as the mean and SE of the number of CFU-GM colonies scored on day 14.
|
|
HGF is Synergistic with IL-11 in the Absence of Serum
We next tested the effect of HGF on CD34+ cells grown in the absence of serum. Background colony levels were reduced to zero at a plating density of 2 x 103 cells/ml. When CD34+ cells were plated in protein-deprived semisolid medium with the same growth factors, the combination of IL-11 (100 ng/ml) and HGF (100 pg/ml) induced cell clusters by seven days (mean = 4.0), and CFU-GM colonies (mean = 9.0) and clusters (mean = 5.0) by 14 days. No cell clusters or colonies were observed under these conditions in protein-deprived cultures in the absence of added cytokines, or in cultures supplemented with GM-CSF, G-CSF, M-CSF, IL-3 or SCF (Table 1
). Thus protein-deprived culture conditions and a plating density of 2 x 103 cells/ml revealed an unexpected and very clear interaction of the two factors HGF and IL-11 to work together to induce a mitogenic signal for CD34+ cells.
IL-11 Upregulates the c-met Receptor on CD34+ Hematopoietic Cells
To investigate the clear interaction of IL-11 and HGF on CD34+ cells in the absence of serum or other cytokines, we next sought to determine whether c-met RNA expression in CB CD34+ cells was upregulated in response to IL-11. The c-met RNA expression from unstimulated or IL-11-stimulated CD34+ cells was compared. In two independent experiments, northern analysis confirmed that c-met expression was upregulated in IL-11-stimulated CD34+ cells, compared with unstimulated control CD34+ cells (Fig. 4
). This was confirmed by densitometric analysis (Table 2
). The data establish that the c-met receptor message was expressed at a higher level in IL-11-stimulated CB CD34+ cells.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4. Northern analysis of IL-11-induced c-met RNA expression. c-met expression is upregulated in IL-11-stimulated CD34+ cells compared to unstimulated controls. NL lane represents total RNA from normal liver cells (positive control), +IL-11 lane represents total RNA from IL-11-stimulated CD34+ cells (100 ng/ml, overnight at 37°C), IL-11 lane represents total RNA from unstimulated CD34+ cells. GAPDH is shown below as an RNA loading control. Densitometry showed a clear and specific increase in c-met (Table 2 ).
|
|
CD34+Thy-1+Lin Stem Cells Express c-met
To determine whether the stimulatory and synergistic effects of IL-11 and HGF in the absence of serum could be attributed to the effects of these cytokines on candidate stem cells, a more primitive population of cells (lin) was next analyzed for the expression of c-met. Flow cytometry was used to sort pre-enriched CD34+ cells into two subpopulations; CD34+Thy-1+Lin (lin) cells (candidate stem cells), and CD34+Thy-1+Lin (lin+) cells. We looked for c-met expression in unstimulated lin and lin+ cells, as well as lin and lin+ cells stimulated with IL-11 either before sorting (stimulating a population containing stem cells), or after CD34+ cells were sorted (stimulating only the stem cell candidate population). Figure 5
illustrates that human lin- cells were positive for c-met transcript as detected by RT-PCR. These results also demonstrate that c-met was expressed in lin- and lin+ cells, both in the presence and absence of IL-11 stimulation. IL-11-stimulated or unstimulated presorted CD34+ progenitor cells were also positive for c-met (Fig. 5
). In these studies, normal liver (NL) RNA was used as a positive control for c-met expression, actin was used as a positive control for reverse transcription and PCR amplification, and to ensure that the RNA from each sample was intact. No band was seen in the negative control lane when reverse transcriptase was eliminated from the reaction (not shown). Thus, the HGF receptor c-met is expressed in human stem cell populations as well as total CD34+ cell populations containing stem cells.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 5. Detection of c-met expression by RT-PCR. For each set of samples (A-E), total RNA was reverse transcribed and amplified with c-met-specific or actin-specific primers. The A lanes show unstimulated lin and lin+ cells; B lanes show lin and lin+ cells stimulated with IL-11 (100 ng/ml, overnight at 37°C) prior to sorting (stimulation of the total CD34+ population containing stem cells); C lanes show lin and lin+ cells stimulated with IL-11 after sorting (IL-11 stimulation of only the candidate stem cell population); D lanes show unstimulated or IL-11-stimulated CD34+ pro-genitor cells; and E lanes show NL cells as a positive control for c-met expression. No band was seen in the negative control lane when reverse transcriptase was eliminated from the reaction (not shown).
|
|
Immunocytochemical staining also demonstrates that in addition to c-met transcript, c-met protein is also expressed in CD34+, lin- and lin+ cells, both in the presence and absence of IL-11 stimulation. Positive and negative controls with NL show that the c-met staining is specific (Fig. 6
).

View larger version (112K):
[in this window]
[in a new window]
|
Figure 6. Immunocytochemical staining of c-met expression in unstimulated and IL-11-stimulated CD34+, lin and lin+ cells. Wright-Giemsa-stained CD34+ cells are shown in (A), lin cells (D), and lin+ cells (G). Unstimulated CD34+ cells (B), lin cells (E), and lin+ cells (H) are positive for c-met protein. IL-11-stimulated CD34+ cells (C), lin (F) and lin+ (I) also show specific staining for c-met. Negative controls of stimulated and unstimulated cell populations showed no specific staining for c-met (not shown). NL was used as positive (K) and negative (J) control for c-met staining.
|
|
 |
Discussion
|
|---|
In the present studies, we compared the effects of HGF alone or in combination with GM-CSF, G-CSF, M-CSF, IL-3, IL-11 or SCF on the formation of CFU-GM colonies by CB CD34+ progenitor cells. HGF did not induce proliferation of CFU-GM above control levels when combined with one factor SCF, IL-3 or IL-11 in serum or when cultures were stimulated with the combination of IL-3, GM-CSF, SCF and Epo. The lack of synergy by HGF was also observed in cultures supplemented with the combination of PHA-LCM + Epo as a source of colony-stimulating factors. When CD34+ cells were plated in serum-deprived semisolid medium with the same growth factors, the combination of IL-11 and HGF produced cell clusters of granulocytes and macrophages (10-40 cells/cluster) as well as CFU-GM (>40 cells/colony) by 14 days. Northern analysis indicated that c-met mRNA expression was upregulated on CD34+ cells in response to IL-11. Thus, we showed that HGF synergistically enhanced the effect of GM-CSF, G-CSF or M-CSF on colony formation by CD34+ cells in semisolid medium in the presence of serum. We demonstrated that c-met, the high-affinity receptor for HGF, was constitutively expressed in CB CD34+ progenitor and lin stem cells.
HGF is a synergistic factor in stimulating the growth of cells already exposed to other hematopoietic growth factors. Our results show that with lin- cells, IL-11 directly stimulates c-met expression in these stem cells rather than indirectly through the release of another humoral mediator by other nonstem cells in the CD34+ population. The present data show that HGF enhances granulocyte-macrophage-forming ability of CB CD34+ cells, and support the conclusion that colony formation in the absence of serum, in cultures stimulated with IL-11 + HGF, is the result of upregulation of the c-met, the HGF receptor by IL-11.
Our results have potential implications for a role of HGF in the hematopoietic microenvironment. HGF is a pleiotropic growth factor which binds to the extracellular matrix of the hematopoietic microenvironment [27]. HGF is secreted by stromal cells of many tissues including those in the lung, bone marrow and other connective tissues. Since GM-CSF and other humoral regulators of hemopoiesis are also bound to the extracellular matrix [29, 31], the present data suggest that interaction of these synergistic factors in the marrow microenvironment might be a natural regulatory mechanism. HGF is also known to stimulate angiogenesis and is produced by committed or differentiated myeloid cells, as well as macrophage and monocyte progenitors [11, 12]. Thus, as with many other synergistic factors, the immediate presence of other combinations of growth factors may determine the stimulatory or inhibitory role of HGF.
The availability of knockout mice lacking HGF and the derivation of bone marrow stromal cell lines from these animals should provide the ability to determine the role of HGF in other aspects of hematopoietic cellular function, including stem cell binding to stromal cells, stem cell differentiation and motility; and the effectiveness of stem cell recovery from irradiation, chemotherapeutic alkylating agents or infectious agents.
The present data may have additional implications with respect to the phenotype of primitive hematopoietic cells thought to be stem cells. Previous publications have demonstrated that primitive hematopoietic cells may express the c-fms/M-CSF receptor or the c-kit/SCF receptor [32-36]. The present results extend this observation with CD34+lin- cells to c-met and indicate that c-met and its ligand, HGF, have a role in stem cell biology within the hematopoietic microenvironment.
 |
Acknowledgements
|
|---|
The authors express appreciation to Beth Ann Showalter of Magee-Women's Research Institute for her efforts in the collection of cord blood samples. We also thank Bob Lakomy and Alex Styche of the UPCI Flow Cytometry Facility for the cell sorting and analysis. Supported by: National Institutes of Health Research Grants CA39851 and DE08798 (JSG), and CA43632, CA35373 and CA30241 (GKM).
 |
Footnotes
|
|---|
Provisionally accepted May 1, 1996.
 |
References
|
|---|
-
Moore MAS. Clinical implications of positive and negative hematopoietic stem cell regulators. Blood 1991; 78:1-19.[Free Full Text]
-
Metcalf D. Hematopoietic regulators: redundancy or subtlety? Blood 1993;82:3515-3523.[Free Full Text]
-
Bernstein ID, Andrews RG, Zsebo KM. Recombinant human stem cell factor enhances the formation of colonies by CD34+ and CD34+lin- cells and the generation of colony-forming cell progeny from CD34+lincells cultured with Interleukin-3, granulocyte colony-stimulating factor, or granulocyte-macrophage colonystimulating factor. Blood 1991;77:2316-2321.[Abstract/Free Full Text]
-
Musashi M, Clark SC, Suodo T et al. Synergistic interactions between Interleukin-11 and Interleukin-4 in support of proliferation of primitive hematopoeitic progenitors of mice. Blood 1991;78:1448-1451.[Abstract/Free Full Text]
-
Musashi M, Yang Y-C, Paul SR et al. Direct and synergistic effects of Interleukin-11 on murine hemopoiesis in culture. Proc Natl Acad Sci USA 1991;88:765-769.[Abstract/Free Full Text]
-
Nakamura TK, Nawa A, Ischihara N et al. Purification and subunit structure of hepatocyte growth factor from rat platelets. FEBS Lett 1987;224:311-316.[Medline]
-
Nakamura T, Nishizawa T, Hagiya M et al. Molecular cloning and expression of human hepatocyte growth factor. Nature 1989;342:440-443.[Medline]
-
Michalopoulos GK. Liver regeneration: molecular mechanisms of growth control. FASEB J 1990;4:176-187.[Abstract]
-
Michalopoulos GK, Zarnegar R. Hepatocyte growth factor. Hepatology 1992;15:149-155.[Medline]
-
Bussolino F, DiRenzo MF, Ziche M et al. Hepatocyte growth factor is a potent angiogenic factor which stimulates endothelial cell motility and growth. J Cell Biol 1992;119(Suppl 3):629-641.[Abstract/Free Full Text]
-
Rubin JS, Bottaro DP, Aaronson SA. Hepatocyte growth factor/scatter factor and its receptor, the c-met proto-oncogene product. Biochem Biophys Acta 1993;1155:357-371.[Medline]
-
Matsummoto K, Nakamura T. Pleiotropic roles of HGF in mitogenesis, morphogenesis, and organ regeneration. Gann Monogr Cancer Res 1994;42:91-112.
-
Bottaro DP, Rubin JS, Faletto DL et al. Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science 1991;251:802-804.[Abstract/Free Full Text]
-
Naldini L, Vigna E, Narsimhan RP et al. Hepatocyte growth factor (HGF) stimulates the tyrosine kinase activity of the receptor encoded by the proto-oncogene c-met. Oncogene 1991;4:501-504.
-
Naldini L, Weidner KM, Vigna E et al. Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET factor. EMBO J 1991;10:2867-2878.[Medline]
-
Weidner KM, Sachs M, Birchmeier W. The Met receptor tyrosine kinase transduces motility, proliferation, and morphogenic signals of scatter factor in epithelial cells. J Cell Biol 1993;121:145-154.[Abstract/Free Full Text]
-
Stoker M, Gherardi E, Perryman M et al. Scatter factor is a fibroblast-derived modulator of epithelial cell mobility. Nature 1987;327:239-242.[Medline]
-
Prat M, Narisman T, Crepaldi MR et al. The receptor encoded by the human c-Met oncogene is expressed in hepatocytes, epithelial cells and solid tumors. Int J Cancer 1991;49:380-385.
-
Wang Y, Selden AC, Morgan N et al. Hepatocyte growth factor/scatter factor expression in human mammary epithelium. Am J Pathol 1994;144:675-682.[Abstract]
-
Montesano RK, Matsumoto T, Nakamura T et al. Identification of a fibroblast-derived epithelial morphogen as hepatocyte growth factor. Cell 1991;67:901-908.[Medline]
-
Rosen EM, Nigam SK, Goldberg ID. Scatter factor and the c-met receptor: a paradigm for mesenchymal/epithelial interaction. J Cell Biol 1994;127(suppl 6):1783-1787.[Abstract/Free Full Text]
-
Soriano JV, Pepper MS, Nakamura T et al. Hepatocyte growth factor stimulates extensive development of branching duct-like structures by cloned mammary gland epithelial cells. J Cell Sci 1995;108:413-430.[Abstract]
-
Zarnegar R, Michalopoulos GK. The many faces of hepatocyte growth factor: from hepatopoiesis to hematopoiesis. J Cell Biol 1995;129:1177-1754.[Free Full Text]
-
Galimi F, Bagnara GP, Bonsi L et al. Hepatocyte growth factor induces proliferation and differentiation of multipotent and erythroid hematopoietic progenitors. J Cell Biol 1994;127(suppl 6):1743-1754.[Abstract/Free Full Text]
-
Kmiecik TE, Keller JR, Rosen E et al. Hepatocyte growth factor is a synergistic factor for the growth of hematopoietic progenitor cells. Blood 1992;80(suppl 10):2454-2457.[Abstract/Free Full Text]
-
Nishino T, Kaise N, Sindo Y et al. Promyleocytic leukemia cell line, HL-60, produces human hepatocyte growth factor. Biochem Biophys Res Commun 1991;181:323-330.[Medline]
-
Nishino T, Hisha H, Nishino N et al. Hepatocyte growth factor as a hematopoietic regulator. Blood 1995;85(suppl 11):3093-3100.[Abstract/Free Full Text]
-
Sonnenberg E, Meyer D, Weidner KM. Scatter factor/hepatocyte growth factor and its receptor the c-met tyrosine kinase, can mediate a signal exchange between mesenchyme and epithelia during mouse development. J Cell Biol 1991;123:223-235.[Abstract/Free Full Text]
-
Matsumoto A, Yamamoto N. Sequestration of hepatocyte growth factor in extracellular matrix in normal adult rat liver. Biochem Biophys Res Commun 1991;174:90-95.[Medline]
-
Miltenyi S, Guth S, Radbruch A et al. Isolation of CD34+ hematopoeitic progenitor cells by high-gradient magnetic sorting. In: Wunder E, ed. Hematopoeitic Stem Cells. Dayton, OH:Alpha Med Press 1994;201-213.
-
Gordon MY, Riley GP, Watt SM et al. Compartmentalization of a hematopoeitic growth factor (GM-CSF) by glycosaminoglycans in the bone marrow microenvironment. Nature 1987;326:403-405.[Medline]
-
Sherr CJ. Colony stimulating factor-1 receptor. Blood 1990;75:1-12.[Free Full Text]
-
Chabot B, Stephenson DA, Chapman VM et al. The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature 1988;335:88-89.[Medline]
-
Broxmeyer HE, Maze R, Miyazawa K et al. The c-kit receptor and its ligand, Steel, as regulators of hemopoiesis. Cancer Cells 1992;3:480-487.
-
Migliaccio G, Migliaccio AR, Druzin ML et al. Long-term generation of colony-forming cells in liquid culture of CD34+ cord blood cells in the presence of recombinant human stem cell factor. Blood 1992;79(suppl 10):2620-2627.[Abstract/Free Full Text]
-
Ikuta K, Weissman IL. Evidence that hematopoietic stem cells express mouse c-kit but do not depend on Steel factor for their generation. Proc Natl Acad Sci USA 1992;89:1502-1506.[Abstract/Free Full Text]
Received April 14, 1996;
accepted for publication May 24, 1996.
