Stem Cells http://www.stemcellsportal.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugiura, K.
Right arrow Articles by Ikehara, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugiura, K.
Right arrow Articles by Ikehara, S.
Stem Cells, Vol. 19, No. 1, 46-58, January 2001
© 2001 AlphaMed Press

Major Histocompatibility Complex Restriction Between Hematopoietic Stem Cells and Stromal Cells In Vitro

Kikuya Sugiuraa, Hiroko Hishaa, Junji Ishikawab, Yasushi Adachia, Shigeru Taketanic, Shinryu Leea, Takashi Nagahamaa, Susumu Ikeharaa

a First Department of Pathology, Transplantation Center, Kansai Medical Center, Moriguchi-City, Japan;
b Tukuba Research Institute, Novartis Pharma, Tukuba-City, Japan;
c Department of Hygiene, Transplantation Center, Kansai Medical Center, Moriguchi-City, Japan

Key Words. Hematopoietic stem cells • Stromal cells • Restriction • MHC Class Ia • Cobblestone colony

Susumu Ikehara, M.D., Ph.D., First Department of Pathology, Kansai Medical University, 10-15 Fumizono, Moriguchi-City, Osaka 570-8506 Japan. Telephone: 81-6-6993-9429; Fax: 81-6-6994-8283; e-mail: ikehara{at}takii.kmu.ac.jp


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously found that a significant number of hematopoietic progenitors accumulate in engrafted bones with the same major histocompatibility complex (MHC) as the transplanted bone marrow cells. In the present study, to further clarify the MHC restriction between hematopoietic stem cells (HSC) and microenvironment, we carried out cobblestone colony formation assays by culturing HSCs with MHC-matched or -mismatched stromal cell monolayers. The formation of cobblestone colonies under MHC-mismatched stromal cells significantly decreased in comparison with MHC-matched stromal cells. However, the decrease in cobblestone colony formation under MHC-mismatched stromal cells was not significant when using MHC class I-deficient HSC or stromal cells. Taken together with the results using B10 congenic strains, it is suggested that the MHC preference is restricted by MHC class Ia molecules. Treatment with monoclonal antibodies (mAbs) against MHC class Ia molecules of stromal cell phenotypes significantly enhanced the cobblestone colony formation, whereas treatment with mAbs against HSC phenotypes significantly inhibited it. The expression of cytokines to promote hematopoiesis was enhanced by the mAbs against stromal cell phenotypes. The enhancement of cytokine expression was also observed when stromal cells and HSCs were MHC-matched. These results suggest that signaling via the MHC molecules augments stromal cell activity and elicits the MHC restriction.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bone marrow transplantation (BMT) is one of the most useful therapies for patients with leukemias, aplastic anemia, immunodeficiencies and autoimmune diseases [1]. However, the transplantation of bone marrow cells (BMCs) from donors who are partially or fully incompatible in major histocompatibility complex (MHC) often results in graft-versus-host-disease (GVHD) or rejection [2, 3]. GVHD is mainly exerted by the host-reactive donor T cells: T helper-type 1 (Th1) cells in acute GVHD and Th2 in chronic GVHD [4]. On the other hand, the mechanisms underlying the rejection are controversial. Since the discovery of natural killer (NK) cell activity, which inhibits the initiation of hematopoiesis, the failure of hematopoietic reconstitution in allogeneic or hybrid hosts has been explained as the rejection exerted by NK cells [5-8] which are genetically controlled by the hematopoietic histocompatibility-1 (Hh-1) system [9]. However, the genes coding the Hh-1 have not been identified, nor can all rejective responses be explained by the Hh-1 or the Ly49 [10] (one of MHC class I-binding receptors) which drives the signals negatively regulating NK activity [11]. Therefore, although the responses of NK cells or donor-reactive host T cells remain the core, it is conceivable that there are other mechanisms involved in the rejection.

Stromal cells, which create the hematopoietic microenvironment, support the proliferation and differentiation of hematopoietic stem cells (HSCs) by direct cell-to-cell interaction with adhesion molecules [12-14] and/or hematopoietic factors [15-18]. The BM stromal cells are reported to generate from the endosteal layer [19]. Indeed, it has been shown that the engraftment of bones provides a hematopoietic microenvironment [20]. We have also found that hematolymphoid reconstitution of BMCs in MHC-incompatible recipients is significantly enhanced when the bones of BM donors are engrafted simultaneously with BMT [21, 22]. More recently, we have found that a significant number of hematopoietic progenitors accumulate in the engrafted bones [23] or spleens [24] that have the same MHC-phenotype as the transplanted BMCs. These findings indicate that HSCs prefer the microenvironment with "self" MHC for their proliferation and differentiation. In the present study, to further clarify the MHC restriction and investigate the mechanisms underlying the restriction, we carried out a cobblestone colony formation assay by culturing HSCs with MHC-compatible or -incompatible stromal cell monolayers. We show that the preference of HSCs for stromal cells (microenvironment) with self MHC exists even in the in vitro system, and that the preference is restricted by MHC class Ia molecules. Furthermore, we show that the expression of cytokines to promote hematopoiesis is enhanced when the MHC of HSCs and stromal cells is matched.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice
BALB/c, C57BL/6 (B6), C3H/HeN (C3H), MRL/MpJ-+/+ (MRL/+), C57BL/10 (B10), B10.BR/SgSn (B10.BR), B10.D2/nSn (B10.D2), and B10.A/SgSn (B10.A) mice were purchased from Japan SLC Inc. (Hamamatsu, Japan). The breeding pairs of beta 2-microglobulin (ß2m)-knock-out (KO) mice strains: C57BL/6J-B2mtmlUnc (B6 KO), MRL/MpJ-B2mtmlUnc (MRL KO), BALB/cJ-B2mtmlUnc (BALB/c KO) and C3H/HeJ-Aw/Aw?-B2mtmlUnc (C3H KO) were purchased from The Jackson Laboratory (Bar Harbor, MA; http://www.jax.org). B10.A (4R)/SgSn and B10.A (5R)/SgSn mice and the ß2m-KO strains were bred in our colony at Kansai Medical University. The original breeding pairs of B10.A (5R) mice were provided by Dr. Kazuo Moriwaki at National Institute of Genetics, Japan (Mishima, Japan), and B10.A (4R) mice were kindly provided by Dr. Kazunori Onoe at the Institute of Immunological Science, Hokkaido University (Sapporo, Japan). Six-week-old male mice or eight- to nine-week-old female mice were used to collect HSCs from BMCs. Table 1Go shows the phenotypes of loci in the MHC of mouse strains used in this study.


View this table:
[in this window]
[in a new window]
 
Table 1. Phenotypes of alleles at H-2 loci of mice
 
Isolation of HSC-Enriched Cell Population
Mice were intravenously injected with 5-fluorouracil (5-FU) (150 mg/Kg: Kyowa Hakko; Tokyo, Japan) dissolved in saline. Four days after the injection, BMCs were collected and fractionated by density centrifugation using a density solution, Lympholite®-Mammal (density, 1.086; Cedarlane; Hornby, Ontaio, Canada; http://www.cedarlanelabs.com). After centrifugation at 500 x g for 30 min, whole mononuclear cells (WMNCs) were collected from the interphase. Cells with lineage markers were then depleted from WMNCs using monoclonal antibodies (mAbs) to murine cell differentiation antigens (Ags) and sheep-antirat IgG immunomagnetic beads (Dynabeads M450; Dynal; Oslo, Norway; http://www.dynal.no; the target cells/beads ratio, 1:10) as previously described [25]; mAbs used in this procedure were antimouse CD4 (clone GK1.5; American Type Culture Collection [ATCC]; Rockville, MD; http://www.atcc.org.), antimouse CD8 (clone 53-6.72; ATCC), antimouse CD11b (clone M1/70.15; ATCC), anti-B220 (clone RA3-6B2; Pharmingen; San Diego, CA; http://www.pharmingen.com) and anti-Gr-1 (clone RB6-8C5; Pharmingen) mAbs. After the depletion, cells with lineage markers were less than 1% by analysis on a FACScan® (Becton Dickinson; Mountain View, CA; http://www.bd.com). Sca-1+ cells were then isolated from the cells without lineage markers (Lin cells) using a magnetic cell separation system (MACS, Miltenyi Biotec GmbH; Bergisch-Gladbach, Germany; http://www.miltenyibiotec.com) and Sca-1 Multisort Kit (Miltenyi Biotec) according to the manufacturer's protocol [26]. In brief, 200 µl of anti-Sca-1 microbeads were used for 1 x 108 cells suspended in 0.8 ml phosphate-buffered saline (PBS) containing 2% fetal calf serum (FCS) (Irvine Scientific; Santa Ana, CA). After incubation at 6°C for 30 min, labeled cells and unlabeled cells were separated in a high gradient magnetic field generated in a steelwool matrix of column inserted into the field of a permanent magnet. The Sca-1+ cells were eluted from the column outside of the magnet. More than 98% of the resultant cells were Sca-1+ by fluorescence-activated cell sorter (FACS) analysis (Fig. 1Go). As a control in the FACS analysis, Sca-1 cells were independently isolated from WMNCs using anti-Sca-1 microbeads and MACS (Fig. 1Go).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 1. Isolation of Sca-1+Lin cell population. The expression of MHC class I (H-2K), Sca-1, B220, and Mac 1/Gr 1 along with size (FSC) and granularity (SSC) of Sca-l+Lincells was compared with that of Sca-l cells.

 
Assay of Cobblestone Colony Formation
Stromal cells were harvested from cultures of fetal bones which were collected from murine fetuses of 13-14 days in gestation. Five thousand of the stromal cells in 0.1 ml Iscove's modified Dulbecco's medium (IMDM) (GIBCO; Grand Island, NY) containing 10% FCS were added to the wells of 96-well plates with flat bottoms. The plates were incubated for at least 48 h to obtain stable stromal monolayers which fully covered the bottom of the wells. The isolated Sca-1+ Lin cells (3 x 104/ml in IMDM 10% FCS) were serially diluted and added to the irradiated (20 Gy) stromal monolayers in the wells. Observation for cobblestone colony formation under the stromal monolayers was performed twice a week, and the percentage of wells with cobblestone colonies (positive wells) was recorded. No cobblestone colony was generated four weeks after the addition of HSCs. After the four-week observation, the percentages of positive wells against the number of Sca-1+Lin cells seeded per well were plotted, and the number of the Sca-1+Lin cells required for cobblestone colony formation in half of the seeded wells (50% colony formation) was graphically evaluated. In some experiments, mAbs to mouse MHC class I Ags (anti-H-2Kb, H-2Kd, H-2Kk, H-2Db, H-2Dd, and H-2Dk mAb; Meiji Milk Products; Tokyo, Japan) were added to cultures for cobblestone colony formation. Final concentrations of the mAbs were determined according to the manufacturer's data sheets. The concentrations were sufficient for lysing the antigen-bearing cells in a complement-dependent cytolysis.

Analyses of Cytokine Production
The production of the following cytokines that regulate the proliferation and differentiation of HSCs was estimated in reverse transcriptase-polymerase chain reaction (RT-PCR) assays: stem cell factor (SCF), Flt3 ligand (Flt3-L), basic fibroblast growth factor (bFGF), interleukin 6 (IL-6), G-CSF, insulin-like growth factor-type 1 (IGF), macrophage inflammatory protein 1{alpha} (MIP-1{alpha}), leukemia inhibitory factor (LIF), and transforming growth factor ß1 (TGF-ß1). In this analysis, stromal cells (5 x 105 in 5 ml IMDM 10% FCS) cultured in a 6-cm culture dish were irradiated and incubated with or without MHC-matched or -mismatched Sca-1+Lin cells (5 x 105) in the presence or absence of mAb to murine MHC class I Ags, as described above. Afer the 8-, 24-, 48-, and 96-h incubation at 37° C, the culture medium was removed. The dish was washed with PBS, and the cultured cells were lysed in 2-ml TRIZOL reagent (GIBCO BRL; Gaithersburg, MD) to extract total RNA. The RNA extraction procedure was performed according to the manufacturer's instructions attached to the TRIZOL reagent. The isolated RNA dissolved in diethylpyrocarbonate-H2O was then employed in RT, in which the reactive solution (20 µl) contained 20 units of Moloney murine leukemia virus-RT (Toyobo; Osaka, Japan), 20 units of Rnase inhibitor (Toyobo), and 50 pmol of random nonamer (Takara Shuzo Co., Ltd.; Ohtu, Japan) in an appropriate RT buffer. The PT-solution was incubated at 37°C for 10 min and at 42°C for 30 min. The reaction was terminated by heating at 100°C for 5 min. Generated cDNAs were amplified in PCR using recombinant Taq DNA polymerase (Toyobo). The following primers were used to detect cytokines: SCF, sense primer, GCTTGACTACTCTTCTGGAC, and antisense primer, CTGCTGTCATTCCTAAGGG with an expected product size of 345 bp [27]; Flt3-L, sense primer, GTTTAGAGAGTTGACTGACCACC, and antisense primer, GGTGGTCAGTCAACTCTCTAAAC with an expected product size of 166 bp; bFGF, sense primer, GCTGCTGGCTTCTAAGTGT, and antisense primer, TACCAACTGGAGTATTTCCGT with an expected product size of 100 bp [28]; G-CSF, sense primer, CCAACTTTGCCACCACCATCT, and antisense primer, GGAGCAGCA- GCAGGAATCAATA with an expected product size of 768 bp [29]; IGF-1, sense primer, GACCGAGGGGCTTTTAC, and antisense primer, TGCTTTTGTAGGCTTCAGTGG with an expected product size of 152 bp [30]; IL-3, sense primer, GCAGCTCTATTGTCAAGGAG, and antisense primer, GCAGAGTCATTCGCAGATGTAG with an expected product size of 216 bp [27]; MIP-1{alpha}, sense primer, ACTGCCCTTGCTGTTCTTCTCT, and antisense primer, AGGCA- ATCAGTTCCAGGTCAGT with an expected product size of 255 bp [29]; LIF, sense primer, GGCAACCTCATGAACCAGATCA, and antisense primer, GCAA- AGCACATTGCTGAGGAGG with an expected product size of 318 bp [31]. Primers for murine TGF-ß1 were purchased from Clontech Laboratories Inc. (Palo Alto, CA; http://www.clontech.com), and for IL-6, GM-CSF, and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) were from Maxim Biotec Inc. (San Francisco, CA). Amplifications (30-35 times) were performed according to protocols previously reported [27-31] or the manufacturers' instructions.

Statistics
Numbers of Sca-1+Lin cells required for a 50% colony formation in each experimental group were compared with analysis of variance and then with paired t test or Tukey-Kramer multiple comparisons test.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Flow Cytometric Analyses of HSC-Enriched Population and Stromal Cells
Isolated Sca-1+Lin cells were examined by flow cytometry. As shown in Figure 1Go, most of the Sca-1+Lin cells showed a low to intermediate forward scatter intensity; the cells had the size of lymphocytes to monocytes, and showed a low side scatter intensity. Compared with Sca-1 cells, the Sca-1+Lin cells highly expressed MHC class I (H-2K) Ags. Since we treated mice with 5-fluorouracil (5-FU) to deplete cells in the cycling phase [32], the expression of c-kit on the isolated cell population was low or negative (data not shown), as we previously described [33]. The population of Sca 1+ Lin cells did not contain B220+/Mac 1+/Gr-1+ cells (Fig.1Go).

The stromal cell population harvested from the cultures of fetal bones showed a high foward and side scatter intensity. The fetal bone stromal cells showed an Ag which is expressed on a preadipose cell line (MC3T3-G2/PA6 [PA6]), and were recognized by the anti-PA6 mAb (Fig. 2Go), as previously described [34]. The Ag is not expressed on the mutant of PA6 which has lost the function to support hematopoiesis (the formation of cobblestone colonies), and the anti-PA6 mAb blocks the supporting function of PA6 [34]. As shown in Figure 2Go, the stromal cells derived from the B6 fetal bones expressed a higher level of MHC class I (H-2K) Ags than PA6 cells. Both the fetal bone stromal cells and PA6 cells expressed a low level of CD105 (VCAM) but not CD4, CD8, CD11b (Mac 1{alpha}), CD11c, Gr 1, B220, or CD45 (data not shown), while 45% of the stromal cells (but not PA6 cells) expressed CD11a (LFA-1a) (data not shown); the stromal cell population did not contain immunocompetent cells which exert cytocidal effects against allogeneic cells. Moreover, monolayers of the stromal cells were irradiated (20 Gy) before the assays for cobblestone colony formation to prevent the generation of endogenous cobblestone colonies.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. Characterization of stromal cells derived from fetal bones. Stromal cells derived from fetal bones of B6 (H-2Kb) mice and a preadipose cell line (MC3T3-G2/PA6) were compared in the expression of MHC class I (H-2Kb) and the PA6-specific protein recognized by anti-PA6 mAb.

 
Significant Decreases in Hematopoiesis of HSCs in Collaboration with MHC-Mismatched Stromal Cells
We plotted the percentage of cobblestone colony-positive wells against the number of Sca-1+Lin cells seeded, and graphically calculated the number of Sca-1+Lin cells required for 50% colony formation: the smaller number indicates more formation of cobblestones. As shown in Table 2Go and Figure 3AGo, about three times more HSCs were required to obtain the 50% colony formation under MHC-mismatched stromal cells (MHC-mismatched cultures) in comparison with that under MHC-matched stromal cells (MHC-matched cultures). In some experiments, we compared cobblestone formation using B10 congenic mouse strains, which have the same genetic background as B10 mice except for MHC (Table 1Go). As shown in Table 2Go (Exp. 5 and Exp. 6), the formation of cobblestone colonies significantly decreased under the stromal cells derived from the congenic mice with different MHC genotypes, whereas the formation did not decrease as much under the stromal cells derived from mice with the same MHC genotype but different in the other genes.


View this table:
[in this window]
[in a new window]
 
Table 2. Formation of cobblestone colonies in MHC-matched or -mismatched combinations using MHC class I+ and MHC class I+ stromal cells
 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Cobblestone colony formation by HSCs under MHC-matched or -mismatched stromal cell-monolayer. Sca-1+LinBMCs were isolated from BMCs of the wild type (+) or class I-deficient (–) BALB/c (H-2d) mice. The formation of cobblestone colonies with various numbers of the BMCs under the stromal cell monolayer derived from fetal bones of the wild-type (+) or class I-deficient (–) BALB/c mice (closed circles) or B6 (H-2b) mice (open circles) was observed.

 
Restriction of MHC Class Ia Molecules
As shown in Table 3Go and Figure 3BGo, the decrease in the cobblestone colony formation in the MHC-mismatched cultures was not significant when HSCs collected from ß2m-deficient (KO) mice, which do not express MHC class I molecules on their cell surface [35], were used. In some experiments, more cobblestone colonies were counted in the MHC-mismatched cultures but not in the matched culture, although there was no significant difference (Table 3Go, Exp. 5 and Exp. 6). Similar results were obtained when HSCs collected from wild-type mice were seeded to cultures of stromal cells collected from the ß2m-deficient mice (Table 4Go and Fig. 3CGo).


View this table:
[in this window]
[in a new window]
 
Table 3. Formation of cobblestone colonies under MHC-matched or -mismatched combinations using MHC class I (ß2m KO) and MHC class I+ stromal cells
 

View this table:
[in this window]
[in a new window]
 
Table 4. Formation of cobblestone colonies in MHC-matched or -mismatched combinations using MHC class I+ and MHC class I (ß2m KO) stromal cells
 
Alloantigens associated with ß2m are not only classical class I molecules in MHC (class Ia, such as H-2K, D, and L molecules), but also class Ib molecules which are coded by Qa or Tla genes [36, 37]. Also, several molecules coded by non-MHC genes, such as CD1[38], FcRn [39], or human cytomegalovirus (HCMV) UL18 [40] have ß2m. Since ß2m-KO mice do not express all of these molecules, we attempted to determine which molecules associated with ß2m exert the restriction between HSCs and stromal cells. To address this, we used conbinations of B10 congenic mouse strains for the cobblestone colony formation assay, in which HSCs and stromal cells were partially compatible in MHC (Table 1Go). As shown in Tables 5 and 6GoGo, the compatibility in MHC class Ib loci between HSCs and stromal cells did not show any influence on the cobblestone colony formation. In contrast, a significantly high number of cobblestones were obtained (almost comparable to that in fully matched cultures) when H-2S, D, and L loci are compatible between HSCs and stromal cells. The compatibility in the H-2K and I loci elicited a relatively large (but not significant) number of cobblestones. Taking these results together with results obtained using ß2m-KO mice, it is suggested that MHC class Ia determines the restriction between HSCs and stromal cells.


View this table:
[in this window]
[in a new window]
 
Table 5. Formation of cobblestone colonies under stromal cells partially compatible in H-2 loci-I
 

View this table:
[in this window]
[in a new window]
 
Table 6. Formation of cobblestone colonies under stromal cells partially compatible in H-2 loci-II
 
Mechanisms Underlying MHC-Restriction Between HSCs and Stromal Cells
To investigate mechanisms underlying the MHC restriction, we mixed HSCs from two mouse strains with different MHC phenotypes, and incubated them with stromal cells collected from one of the two strains. It was expected that, if the MHC compatibility only affects the HSCs (promoting mobility, proliferation, or differentiation) but not the stromal cells, the cobblestone formation by the mixed HSCs may be intermediate between that in the MHC-matched and mismatched cultures. However, if the compatibility affects not only the HSCs but also the stromal cells (promoting the production of hematopoietic cytokines and other supporting molecules), the cobblestone formation in the mixed HSC cultures may be the same as that in MHC-matched cultures. As shown in Table 7Go, the mixed HSCs formed cobblestone colonies the same as syngeneic HSCs. From these results, it is suggested that MHC-class Ia Ags not only on the HSCs but also on the stromal cells are involved in the MHC restriction.


View this table:
[in this window]
[in a new window]
 
Table 7. Formation of cobblestone colonies by mixed HSCs with different MHC
 
To clarify the role of HMC class Ia Ags expressed either on HSCs or stromal cells in the MHC restriction, we added mAbs against MHC class Ia (H-2K or H-2D) into the cultures for the cobblestone colony formation. As shown in Figure 4A and 4BGo, a significant decrease in the cobblestone colony formation was observed by the addition of the mAb against MHC class Ia of HSC phenotypes. It is noteworthy that the decrease in the cobblestone colony formation was observed not only in the MHC-matched cultures but also in the MHC-mismatched cultures. Anti-H-2K mAbs exerted more potent inhibition in the MHC-matched cultures compared with the effect of anti-H-2D mAbs. Unexpectedly and surprisingly, a significant enhancement of the cobblestone colony formation was observed when the mAbs against MHC-class Ia of stromal phenotypes were added to the MHC-mismatched cultures. By adding these mAbs, the cobblestone colony formation in the MHC-mismatched cultures increased to that in the MHC-matched cultures. In this enhancement, anti-H-2K mAbs exerted the same enhancement as anti-H-2D mAbs. From these results, it is expected that the stimulation of MHC class Ia molecules on the stromal cells may promote the expression of cytokines which enhance hematopoiesis of HSCs or/and suppress the expression of cytokines which negatively regulate hematopoiesis.




View larger version (40K):
[in this window]
[in a new window]
 
Figure 4. A) Effect of anti-MHC class I (H-2K) mAbs on formation of cobblestone colonies under MHC-matched or -mismatched stromal cell monolayer. Various numbers of the Sca 1+ Lin BMCs isolated from C57BL/10 (B10: H-2b) or B10.BR (H-2k) mice were added to the cultures of stromal cells from B10 or B10.BR fetal bones. The formation of cobblestone colonies in the presence of anti-H-2K mAbs of the HSC phenotype (closed circles), stromal cell phenotypes (closed squares), or unrelated phenotype (H-2Kd: closed triangles). Open triangles in the figure indicate the formation of cobblestone colonies in the cultures without the mAbs. The mean of six experiments independently performed are shown. B) Effect of anti-MHC class I (H-2D) mAbs on formation of cobblestone colonies under MHC-matched or -mismatched stromal cell-monolayer. Various numbers of the Sca 1+Lin BMCs isolated from C57BL/10 (B10: H-2b) or B10.BR (H-2k) mice were added to the cultures of stromal cells from B10 or B10.BR fetal bones. The formation of cobblestone colonies in the presence of anti-H-2D mAbs of the HSC phenotype (closed circles), stromal cell phenotypes (closed squares) or unrelated phenotype (H-2Dd: closed triangles). Open triangles in the figure indicate the formation of cobblestone colonies in the cultures without the mAbs. Mean of six experiments independently performed are shown.

 
As a next step, we examined the expression of cytokines from stromal cells in the presence of mAbs to MHC class Ia of HSC—or stromal cell-phenotypes. As shown in Figure 5Go, the enhancement in the expression of cytokines which promotes hematopoiesis such as SCF [41], Flt3-L [42, 43] (up to 48 h), bFGF [44, 45], and IL-6 [41, 46] (up to 48 h) was observed in the cultures of stromal cells with MHC-incompatible HSCs and mAbs against MHC class Ia of stromal phenotypes. The expression of cytokines which negatively regulate hematopoiesis such as MIP [47, 48], LIF [49], and TGF-ß1 [47, 50] was not changed in the cultures. However, the enhancement of the cytokine production by anti-stromal cell-class Ia mAbs did not take place in the absence of the MHC-incompatible HSCs. We finally investigated whether the expression of hematopoiesis-promoting cytokines is actually enhanced in the MHC-matched cultures but not in the MHC-incompatible cultures. As shown in Figure 6Go, in addition to an increase in the expression of SCF, Flt3-L, and IL-6, a decrease in the expression of MIP and TGF-ß1 was observed in the MHC-matched cultures, but not in the mismatched cultures or cultures solely containing stromal cells.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 5. Expression of cytokines in stromal cell cultures after treatment with anti-MHC class I mAbs. Expression of the indicated cytokines in cultures of stromal cells after the addition of mAbs to MHC class I and MHC-mismatched HSCs is shown. Lane 1 indicates stromal cell cultures to which were added the mAbs against stromal cell-phenotypes and the MHC-mismatched HSCs. Lane 2: the cultures with the mAbs to HSC-phenotypes and the MHC-mismatched HSCs. Lane 3: the cultures with the mAbs to stromal cell phenotypes and no HSCs. Lane 4: the cultures with no mAbs or HSCs. Experiments were performed two times using stromal cells (and HSCs) from B10.D2 and B10.BR mice. Reproducible results were obtained. Representative data are therefore shown.

 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 6. Expression of cytokines in stromal cell cultures after addition of MHC-matched or -mismatched HSCs. Expression of the indicated cytokines in cultures of stromal cells after the addition of the MHC-matched or -mismatched HSCs is shown. Lane 1 indicates stromal cell cultures to which were added the MHC-matched HSCs. Lane 2: the cultures with the MHC-mismatched HSCs. Lane 3: the cultures with no HSCs. Experiments were performed two times using stromal cells (and HSCs) from B10.D2 and B10.BR mice. Reproducible results were obtained. Representative data are therefore shown.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously found that, when BMCs and bones obtained from various mouse strains are transplanted into lethally irradiated mice, statistically significant numbers of cells accumulate in the engrafted bone which has the same H-2 phenotype as that of the transplanted BMCs (MHC-compatible bones), whereas only a few cells are detected in the engrafted bones of the third-party H-2 phenotypes (MHC-incompatible bones) [23]. Moreover, the BMCs obtained from the MHC-compatible bones showed significant numbers of hematopoietic progenitor cells in comparison with the incompatible bones. These findings suggest that HSCs prefer to settle (home), proliferate and differentiate in the microenvironments that have their own MHC. Furthermore, we have found that a significantly large number of spleen colony-forming units (CFU-S) on day 12 are observed in MHC-compatible recipients, while only a small number are observed in MHC-incompatible recipients. There was, however, no significant difference in CFU-S counts on day 8 between the two groups [24]. CFU-S counts on day 12 are thought to reflect the number of primitive HSCs, while CFU-S counts on day 8 are thought to more closely reflect the number of progenitor cells committed to the erythroid lineage [51]. These results suggest that HSCs require a microenvironment with their own MHC not only in long-term maintenance of hematopoiesis but also in the initiation of hematopoiesis. In these studies, treatment with mAbs against T and NK cells to rule out rejection did not increase either the number of accumulated progenitor cells in the grafted bones or the CFU-S counts on day 12 in the spleens of the MHC-incompatible mice. However, it is difficult in in vivo assays to completely and continuously deplete the T and NK cells from recipient mice by these mAbs, and to avoid unknown effects of the other types of cells and factors. Therefore, to further clarify the MHC preference between HSCs and stromal cells and investigate the mechanisms underlying the preference, we analyzed the cobblestone colony formation of HSCs under the monolayers of the MHC-matched and -mismatched stromal cells derived from fetal bones. Since the cobblestone colony is composed solely of cells which are phenotypically identical to HSCs [52, 53], and since the cobblestone area-forming cells differentiate not only into myeloid and erythroid but also lymphoid cells [54, 55], the cobblestone assay permits the direct measurement of differentiating HSCs in the context of the interaction with stromal cells. In the present study, we have shown that two to five times more HSCs are required for obtaining 50% cobblestone colony formation when BMCs were added to the MHC-mismatched stromal cell layers (Table 2Go). These findings directly demonstrate that the MHC preference indeed exists in the interaction between HSCs and stromal cells.

The preference was, however, not observed when HSCs or stromal cells collected from the class I-deficient (ß2m-KO) mice were employed in the cobblestone colony assays (Tables 3 and 4GoGo). Taking these findings together with results of experiments using B10 congenic mice (Tables 5 and 6GoGo), it is suggested that the MHC preference between HSCs and stromal cells is restricted by MHC class Ia molecules. These results are supported by findings of our previous report [24] and the study of Lengerrová et al. [56] indicating that a significantly large number of CFU-S on day 12 are observed when BMC donors and recipients are compatible in the H-2D locus. Furthermore, from clinical studies, it has been reported that the matching of MHC class I (HLA-A and B) but not class II alleles (HLA-DRB1, DQA1, DQB1, DPA1, and DPB1) is crucial for survival after unrelated BMT [3]. However, it has also been reported that not only incompatibility in a class I (HLA-B) locus, but also in a class II (HLA-D) locus, causes graft failure in BMT [2]. In addition, mAbs against MHC class II have inhibited the proliferation and differentiation of canine HSCs in vivo [57] and human HSCs in vitro [58]. In spite of these results, the stimulation of MHC class II molecules is considered not to directly act on stromal cells, but to indirectly affect them via the activation of macrophages and endothelial cells [59]. In contrast, the stimulation of MHC class I molecules directly affected the stromal cells in the present study; the addition of mAbs against MHC class I of the stromal cell phenotype significantly augmented the cobblestone colony formation (Fig. 4Go) and the expression of cytokines which promote the proliferation/differentiation of HSCs (Fig. 5 and 6GoGo). There is evidence indicating that signal transduction takes place after the stimulation of MHC class I molecules [60, 61].

In the absence of cell-to-cell contact with HSCs, the expression of cytokines in the stromal cells did not increase even after the addition of anti-stromal cell-class I mAbs (Fig. 5Go). In addition, the cobblestone colony formation became not significantly different between the MHC-matched and mismatched cultures when the large number of HSCs were added to the stromal cell cultures (Figs. 3 and 4GoGo). From these results, it is suggested that the function of the stromal cells to support hematopoiesis of HSCs is mainly elicited by signals from adherent molecules other than MHC class I molecules, such as CD9 [62], beta 1 integrin (CD29) [63], CD44 [63], and VCAM-1 (CD106) [64], and that the signals from MHC class Ia molecules may amplify these signals to augment the supporting activity of stromal cells. Also, these results may be a reasonable explanation for the data reported by Bachar-Lustig et al. [65] and Reisner et al.[66] that a megadose of HSCs has succeeded in reconstituting immunohematopoietic systems in the MHC-incompatible recipients (microenvironments).

In contrast to the stimulative effect of the mAbs against MHC class Ia of the stromal cell phenotypes, the addition of mAbs against MHC class Ia of HSC phenotypes decreased the number of cobblestone colonies. The inhibitory effect may be due not only to the blocking of interaction between HSCs and stromal cells via MHC class Ia, but also the generation of signals in HSCs which negatively regulate the proliferation and/or differentiation of HSCs, since the inhibitory effect of the anti-HSC phenotype mAbs was observed not only in the MHC-matched cultures but also in the MHC-mismatched cultures. However, if this is the case, the negative signals may be overridden or inhibited by cytokines [57] produced from the stromal cells when HSCs are placed in the MHC-matched microenvironment, since the expression of cytokines to promote hematopoiesis was also enhanced in the MHC-matched cultures (Fig. 6Go) as well as the MHC-mismatched cultures additionally stimulated with mAbs against class Ia of the stromal cell phenotype (Fig. 5Go).

Pluripotent HSCs have been identified as a cell population highly expressing MHC class Ia (H-2K) molecules [67, 68]. The evidence seems to lead to a conception that the MHC restriction between HSCs and microenvironment acts solely on the HSC side. In the present study, however, we have found both HSCs and stromal cells are affected by the MHC restriction. To further clarify the mechanism underlying the MHC restriction, we are in the process of isolating molecules that bind to the MHC class Ia molecules for eliciting the restriction and investigating signal transduction after the stimulation of the class Ia molecules. Recently, we have found that the HSCs of autoimmune-prone mouse strains are not involved in the MHC restriction [69]. Therefore, clarification of the mechanisms underlying the MHC restriction seems to be crucial not only in preventing rejection but also in analyzing the disorder of HSCs.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The authors thank Mari Sinkawa, Yoko Tokuyama, and Sachiko Miura for their expert technical assistance, and Keiko Ando and Mr. Hilary Eastwick-Field for their help in the preparation of the manuscript. This work was supported by a grant-in-aid for scientific research (C) 10670973, grants-in-aid for scientific research on priority areas (A) 10181225 and 11162221 and a grant from the "Haiteku Research Center" of the Ministry of Education, Science, Sports, and Culture, and grants-in-aid for scientific research (C) 11670229 and (B) 11470062 of the Japan Society for the Promotion of Science.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Good RA. Organization and development of the immune system. Relation to its reconstitution. Ann NY Acad Sci 1995;770:8-33.[Medline]

  2. Anasetti C, Amos D, Beatty PG et al. Effect of HLA compatibility on engrafment of bone marrow transplantations in patients with leukemia or lymphoma. N Engl J Med 1989;320:197-204.[Abstract]

  3. Sasazuki T, Juji T, Morishima Y et al. Effect of class I HLA alleles on clinical outcome after transplantation of hematopoietic stem cells from an unrelated donor. N Engl J Med 1998;339:1177-1185.[Abstract/Free Full Text]

  4. Hakim FT, Mackall CL. The immune system: effector and target of graft-versus-host disease. In: Ferrara JLM, Deeg HJ, Burakoff SJ, eds. Graft-vs.-host disease (2nd ed.). New York: Marcel Dekker Inc., 1997:257-289.

  5. Murphy MJ, Kumar V, Bennett M. Rejection of bone marrow allografts by mice with severe combined immune deficiency (SCID). Evidence that natural killer cells can mediate the specificity of marrow graft rejection. J Exp Med 1987;165:1212-1217.[Abstract/Free Full Text]

  6. Shimamura K, Kaminsky SG, Nakamura I. Acute rejection of allogeneic hematopoietic progenitors by genetically resistant mice. Eur J Immunol 1989;19:1165-1170[Medline]

  7. Dennert G, Knobloch C, Sugawara S et al. Evidence for differentiation of NK1+ cells into cytotoxic T cells during acute rejection of allogeneic bone marrow grafts. Immunogenetics 1990;31:161-168.[Medline]

  8. Ferrara JLM, Mauch P, Dijken PJV et al. Evidence that anti-asialo GM1 in vivo improves engraftment of T cell-depleted bone marrow in hybrid recipients. Transplantation 1990;49:134-138.[Medline]

  9. Rembecki RM, Kumar V, David CS et al. Polymorphism of Hh-1, the mouse hematopoietic histocompatibility locus. Immunogenetics 1988;28:158-170.[CrossRef][Medline]

  10. Held W, Dorfman JR, Wu M et al. Major histocompatibility complex class I-dependent skewing of the natural killer cell Ly49 receptor reportoire. Eur J Immunol 1996;26:2286-2292.[Medline]

  11. Drizlikh G, Schmidt-Sole J, Yankelevich B. Involvement of the K and I regions of the H-2 complex in resistance to hematopoietic allograft. J Exp Med 1984;159:1070-1082.[Abstract/Free Full Text]

  12. Koenigsmann M, Griffin JD, DiCarlo J et al. Myeloid and erythroid progenitor cells from normal bone marrow adhere to collagen type I. Blood 1991;80:657-665.

  13. Simmons PJ, Masinovsky B, Longecker BM et al. Vascular cell adhesion molecule-1 expressed by bone marrow stromal cells mediates the binding of hematopoietic progenitor cells. Blood 1992;80:388-395.[Abstract/Free Full Text]

  14. Yanai N, Sekine C, Yagita H et al. Role of integrin very late activation antigen-4 in stroma-dependent erythropoiesis. Blood 1994;83:2844-2855.[Abstract/Free Full Text]

  15. Tsa S, Emerson SG, Shieff CA et al. Isolation of a human stromal cell strain secreting hemopoietic growth factors. J Cell Physiol 1986;127:137-145.[CrossRef][Medline]

  16. Funk PE, Stephan RP, Witte PL. Vascular cell adhesion molecule 1-positive reticular cells express interleukin-7 and stem cell factor in the bone marrow. Blood 1995;86:2661-2671.[Abstract/Free Full Text]

  17. Huss R, Hoy CA, Deeg HJ. Contact-and growth factor-dependent survival in canine marrow-derived stromal cells. Blood 1995;85:2414-2421.[Abstract/Free Full Text]

  18. Ogasawara H, Tsuji T, Hirano D et al. Induction of IL-6 production by bone marrow stromal cells on the adhesion of IL-6-dependent hematopoietc cells. J Cell Physiol 1996;169:209-216.[CrossRef][Medline]

  19. Fan H, Yasumizu R, Sugiura K et al. Histogenesis of hematopoietic bone marrow in adult mice. Exp Hematol 1990;18:159-166.[Medline]

  20. Friedenstein AJ, Ivanov-Smolenski AA, Chajlakjan RK et al. Origin of bone marrow stromal mechanocytes in radiochimeras and heterotopic transplants. Exp Hematol 1978;6:440-444.[Medline]

  21. Ishida T, Inaba M, Hisha H et al. Requirement of donor-derived stromal cells in the bone marrow for successful allogeneic bone marrow transplantation. Complete prevention of recurrence of autoimmune diseases in MRL/Mp-lpr/lpr mice by transplantation of bone marrow plus bones (stromal cells) from the same donor. J Immunol 1994;152:3119-3127.[Abstract]

  22. Hisha H, Nishino T, Kawamura M et al. Successful bone marrow transplantation by bone grafts in chimeric-resistant combination. Exp Hematol 1995;23:347-352.[Medline]

  23. Hashimoto F, Sugiura K, Inoue K et al. Major histocompatibility complex restriction between hematopoietic stem cells and stromal cells in vivo. Blood 1997;89:49-54.[Abstract/Free Full Text]

  24. Sugiura K, Inaba M, Hisha H et al. Requirement of major histocompatibility complex-compatible microenvironment for spleen colony formation (CFU-S on day 12 but not on day 8). STEM CELLS 1997;15:461-468.[Abstract/Free Full Text]

  25. Sugiura K, Pahwa S, Yamamoto Y et al. Characterization of natural suppressor cells in human bone marrow. STEM CELLS 1998;16:99-106.[Abstract/Free Full Text]

  26. Miltenyi S, Müller W, Weichel W et al. High gradient magnetic cell separation with MACS. Cytometry 1990;11:231-238.[CrossRef][Medline]

  27. Tse K-F, Morrow JK, Hughes NK et al. Stromal cell lines derived from LP-BN5 murine leukemia virus-infected long-term bone marrow cultures impair hematopoiesis in vitro. Blood 1994;84:1508-1518.[Abstract/Free Full Text]

  28. Pessina A, Neri MG, Mineo E et al. Expression of B cell markers on SR-4987 cells derived from murine bone marrow stroma. Exp Hematol 1997;25:536-541.[Medline]

  29. Tanaka T, Akira S, Yoshida K et al. Targeted disruption of the NF-IL6 discloses its essential role in bacteria killing and tumor cytotoxicity by macrophages. Cell 1995;80:353-361.[CrossRef][Medline]

  30. Hana V, Murphy LJ. Interdependence of epidermal growth factor and insulin-like expression in the mouse uterus. Endocrinology 1994;135:107-112.[Abstract]

  31. Wang Z, Ren S, Melmed S. Hypothalamic and pituitary leukemia inhibitory factor gene expression in vitro: a novel endotoxin-inducible neuro-endocrine interface. Endocrinology 1996;137:2947-2953.[Abstract]

  32. Inaba M, Ogata H, Toki J et al. Isolation of murine pluripotent hemopoietic stem cells in the G0 phase. Biochem Biophys Res Commun 1987;147:687-694.[CrossRef][Medline]

  33. Doi H, Inaba M, Yamamoto Y et al. Pluripotent hematopoietic stem cells are c-kit<low. Proc Natl Acad Sci USA 1997;94:2513-2517.[Abstract/Free Full Text]

  34. Izumi-Hisha H, Than S, Ogata H et al. Monoclonal antibodies against a preadipose cell line (MC3T3-G2/PA6) which can support hemopoiesis. Hybridoma 1991;10:103-112.[Medline]

  35. Koller BH, Marrack P, Kappler JW et al. Normal development of mice deficient in ß2M, MHC class I proteins, and CD8+ T cells. Science 1990;248:1227-1230.[Abstract/Free Full Text]

  36. Stroynowski I. Molecules related to class-I major histocompatibility complex antigens. Ann Rev Immunol 1990;8:501-530.[CrossRef][Medline]

  37. Klein J, Benoist C, David CS. Revised nomenclature of H-2 genes. Immunogenetics 1990;32:147-152.[CrossRef][Medline]

  38. Calabi F, Milstein C. A novel family of human major histocompatibility complex-related genes not mapping to chromosome 6. Nature 1986;323:540-543.[CrossRef][Medline]

  39. Simister NE, Mostov KE. An Fc receptor structurally related to MHC class I antigens. Nature 1989;337:184-187.[CrossRef][Medline]

  40. Beck S, Barrell BG. Human cytomegalovirus encodes a glycoprotein homologous to MHC class I antigens. Nature 1988;331:269-272.[CrossRef][Medline]

  41. Xu MJ, Tsuji K, Ueda T et al. Stimulation of mouse and human primitive hematopoiesis by murine embryonic aorta-gonad-mesonephros-derived stroma cell lines. Blood 1998;92:2032-2040.[Abstract/Free Full Text]

  42. Haylock DN, Horsfall MJ, Dowse TL et al. Increased recruitment of hematopoietic progenitor cells underlies the ex vivo expansion potential of FLT3 ligand. Blood 1997;90:2260-2272.[Abstract/Free Full Text]

  43. Hudak S, Hunte B, Culpepper J et al. FLT3/FLK2 ligand promotes the growth of murine stem cells and the expansion of colony-forming cells and spleen colony-forming units. Blood 1995;85:2747-2755.[Abstract/Free Full Text]

  44. Huang S, Terstappen LW. Lymphoid and myeloid differentiation of single human CD34+, HLA-DR+, CD38 hematopoietic stem cells. Blood 1994;83:1515-1526.[Abstract/Free Full Text]

  45. Gabbianelli M, Sargiacomo M, Pelosi E et al. "Pure" human hematopoietic progenitors. Permissive action of basic fibroblast growth factor. Science 1990;249:1561-1564.[Abstract/Free Full Text]

  46. Kollet O, Aviram R, Chebath J et al. The soluble interleukin-6 (IL-6) receptor/IL-6 fusion protein enhances in vitro maintenance and proliferation of human CD34(+) CD38(-/low) cells capable of repopulating severe combined immunodeficiency mice. Blood 1999;94:923-931.[Abstract/Free Full Text]

  47. Cashman JD, Clark-Lewis I, Eaves AC et al. Differentiation stage-specific regulation of primitive human hematopoietic cycling by exogenous and endogenous inhibitors in an in vivo model. Blood 1999;94:3722-3729.[Abstract/Free Full Text]

  48. Graham GJ, Wright EG, Hewick R et al. Identification and characterization of an inhibitor of hematopoietic stem cell proliferation. Nature 1990;344:442-444.[CrossRef][Medline]

  49. Liebermann DA, Hoffman B. Differentiation primary response genes and proto-oncogenes as positive and negative regulators of terminal hematopoietic cell differentiation. STEM CELLS 1994;12:352-369.[Abstract]

  50. Sitnicka E, Ruscetti FW, Priestley GV et al. Transforming growth factor beta 1 directly and reversibly inhibits the initial cell division on long-term repopulating hematopoietic stem cells. Blood 1996;88:82-88.[Abstract/Free Full Text]

  51. Magli MC, Iscove NN, Odarcheno N. The transient nature of early hematopoietic spleen colony forming units. Nature 1982;295:527-529.[CrossRef][Medline]

  52. Weibeaecher K, Weissman I, Blume K et al. Culture of phenotypically defined hematopoietic stem cells and other progenitors at limiting dilution on dexter monolayers. Blood 1991;78:945-952.[Abstract/Free Full Text]

  53. Ploemacher RE, van der Sluijs JP, van Beurden CAJ et al. Use of limiting-dilution type long-term marrow cultures in frequency analysis of marrow-repopulating and spleen colony-forming hematopoietic stem cells in the mouse. Blood 1991;78:2527-2533.[Abstract/Free Full Text]

  54. Okuyama R, Koguma M, Yanai N et al. Bone marrow stromal cells induce myeloid and lymphoid development of the sorted hematopoietic stem cells in vitro. Blood 1995;86:2590-2597.[Abstract/Free Full Text]

  55. Koguma M, Matsuda K, Okuyama R et al. Selective proliferation of lymphoid cells from lineage ckit+ Sca1+ cells by a clonal bone marrow stromal cell line. Exp Hematol 1998;26:280-287.[Medline]

  56. Lengerova A, Matousek V, Zelenÿ V. Analysis of deficient colony-forming performance of bone marrow cells in non-syngenic cell milieu. The impact of non-immune interactions on the behaviour of pluripotent stem cells and the role of H-2 gene products. Transplant Rev 1973;15:89-122.[Medline]

  57. Deeg HJ, Beckham C, Huss R et al. Rescue from anti-MHC class II antibody-mediated marrow graft failure by c-kit ligand. Blood 1994;83:2352-2359.[Abstract/Free Full Text]

  58. Greinix HT, Storb R, Bartelmez SH. Specific growth inhibition of primitive hematopoietic progenitor cells mediated through monoclonal antibody binding to major histocompatibility class II molecules. Blood 1992;80:1950-1956.[Abstract/Free Full Text]

  59. Huss R, Deeg HJ. MHC antigens and hematopoiesis. Transplant Immunol 1994;2:171-175.[CrossRef][Medline]

  60. Bian H, Reed EF. Alloantibody-mediated class I signal transduction in endothelial cells and smooth muscle cells. Enhancement by IFN-{gamma} and TNF-ß. J Immunol 1999;163:1010-1018.[Abstract/Free Full Text]

  61. Skov S. Intracellular signal transduction mediated by ligation of MHC class I molecules. Tissue Antigens 1998;51:215-223.[Medline]

  62. Tanio Y, Yamazaki H, Miyake K et al. CD9 molecule expressed on stromal cells is involved in osteoclastogenesis. Exp Hematol 1999;27:853-859.[CrossRef][Medline]

  63. Oostendorp RA, Spitzer E, Reisbach G et al. Antibodies to the beta 1-integrin chain, CD44, or ICAM-3 stimulate adhesion of blast colony-forming cells and may inhibit their growth. Exp Hematol 1997;25:345-349.[Medline]

  64. Oostendorp RA, Reisbach G, Spitzer E et al. VLA-4 and VCAM-1 are the principal adhesion molecules involved in the interaction between blast colony-forming cells and bone marrow stromal cells. Br J Haematol 1995;91:275-284.[Medline]

  65. Bachar-Lustig E, Rachamim N, Li HW et al. Megadose of T cell-depleted bone marrow overcomes MHC barriers in sublethally irradiated mice. Nat Med 1995;1:1268-1273.[CrossRef][Medline]

  66. Reisner Y, Martelli MF. Bone marrow transplantation across HLA barriers by increasing the number of transplanted cells. Immunol Today 1995;16:437-440.[CrossRef][Medline]

  67. Visser JWM, Bauman JGJ, Mulder AH et al. Isolation of murine pluripotent hematopoietic stem cells. J Exp Med 1984;59:1576-1590.

  68. Ogata H, Bradley WG, Inaba M et al. Long-term repopulation of hematolymphoid cells with only a few hemopoietic stem cells in mice. Proc Natl Acad Sci USA 1995;92:5945-5949.[Abstract/Free Full Text]

  69. Kawamura M, Hisha H, Li Y et al. Distinct qualitative difference between normal and abnormal hematopoietic stem cells in vivo and in vitro. STEM CELLS 1997;15:56-62.[Abstract/Free Full Text]

Received September 5, 2000; accepted for publication October 23, 2000.



This article has been cited by other articles:


Home page
Stem CellsHome page
M. Inaba, Y. Adachi, H. Hisha, N. Hosaka, M. Maki, Y. Ueda, Y. Koike, T. Miyake, J. Fukui, Y. Cui, et al.
Extensive Studies on Perfusion Method Plus Intra-Bone Marrow-Bone Marrow Transplantation Using Cynomolgus Monkeys
Stem Cells, August 1, 2007; 25(8): 2098 - 2103.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Q. Li, H. Hisha, R. Yasumizu, T.-X. Fan, G.-X. Yang, Q. Li, Y.-Z. Cui, X.-L. Wang, C.-Y. Song, S. Okazaki, et al.
Analyses of Very Early Hemopoietic Regeneration After Bone Marrow Transplantation: Comparison of Intravenous and Intrabone Marrow Routes
Stem Cells, May 1, 2007; 25(5): 1186 - 1194.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
X. Wang, H. Hisha, W. Cui, C. Song, T. Mizokami, S. Okazaki, Q. Li, W. Feng, J. Kato, S. Jiang, et al.
The characteristics of hematopoietic stem cells from autoimmune-prone mice and the role of neural cell adhesion molecules in abnormal proliferation of these cells in MRL/lpr mice
Haematologica, March 1, 2007; 92(3): 300 - 307.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Nakao, H. Toyokawa, K. Kimizuka, M. A. Nalesnik, I. Nozaki, R. J. Bailey, A. J. Demetris, T. E. Starzl, and N. Murase
Simultaneous bone marrow and intestine transplantation promotes marrow-derived hematopoietic stem cell engraftment and chimerism
Blood, August 15, 2006; 108(4): 1413 - 1420.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Y. Suzuki, Y. Adachi, K. Minamino, Y. Zhang, M. Iwasaki, K. Nakano, Y. Koike, and S. Ikehara
A New Strategy for Treatment of Malignant Tumor: Intra-Bone Marrow-Bone Marrow Transplantation Plus CD4- Donor Lymphocyte Infusion
Stem Cells, March 1, 2005; 23(3): 365 - 370.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Y. Zhang, Y. Adachi, Y. Suzuki, K. Minamino, M. Iwasaki, H. Hisha, C. Y. Song, K. Kusafuka, K. Nakano, Y. Koike, et al.
Simultaneous Injection of Bone Marrow Cells and Stromal Cells into Bone Marrow Accelerates Hematopoiesis In Vivo
Stem Cells, December 1, 2004; 22(7): 1256 - 1262.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
T.-X. Fan, H. Hisha, T.-N. Jin, K. Sugiura, M. Inaba, G.-X. Yang, Q. Li, X.-L. Wang, C.-Y. Song, Y.-Z. Cui, et al.
Induction of Tolerance in Quadruple Chimeric Mice
Stem Cells, September 1, 2004; 22(5): 683 - 695.
[Abstract] [Full Text] [PDF]