Stem Cells http://www.stemcellsportal.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kijowski, J.
Right arrow Articles by Ratajczak, M. Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kijowski, J.
Right arrow Articles by Ratajczak, M. Z.
Stem Cells, Vol. 19, No. 5, 453-466, September 2001
© 2001 AlphaMed Press

The SDF-1-CXCR4 Axis Stimulates VEGF Secretion and Activates Integrins but does not Affect Proliferation and Survival in Lymphohematopoietic Cells

Jacek Kijowskia, Monika Baj-Krzyworzekaa, Marcin Majkaa, Ryan Recaa, Leah A. Marquezb, Melpo Christofidou-Solomidoua, Anna Janowska-Wieczorekb,c, Mariusz Z. Ratajczaka,d

a Department of Pathology & Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA, USA;
b Canadian Blood Services, Edmonton, Alberta, Canada;
c Department of Medicine, University of Alberta, Edmonton, Alberta, Canada;
d James Graham Brown Cancer Center, Louisville, KY, USA

Key Words. Chemokines • Lymphocytes • Apoptosis • Cellular proliferation • Protein kinases

Mariusz Z. Ratajczak, M.D., Ph.D., Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, University of Pennsylvania, 405A Stellar Chance Labs, 422 Curie Blvd., Philadelphia, Pennsylvania 19104, USA. Telephone: 215-573-3434; Fax: 215-573-6317; e-mail: mariusz{at}mail.med.upenn.edu


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To better define the role HIV-related chemokine receptor-chemokine axes play in human hematopoiesis, we investigated the function of the CXCR4 and CCR5 receptors in human myeloid, T- and B-lymphoid cell lines selected for the expression of these receptors (CXCR4+, CXCR4+ CCR5+, and CCR5+ cell lines). We evaluated the phosphorylation of MAPK p42/44, AKT, and STAT proteins and examined the ability of the ligands for these receptors (stromal-derived factor-1 [SDF-1] and macrophage inflammatory protein-1ß [MIP-1ß]) to influence cell growth, apoptosis, adhesion, and production of vascular endothelial growth factors (VEGF), matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs) in these cell lines. We found that A) SDF-1, after binding to CXCR4, activates multiple signaling pathways and that in comparison with the MIP-1ß-CCR5 axis, plays a privileged role in hematopoiesis; B) SDF-1 activation of the MAPK p42/44 pathway and the PI-3K-AKT axis does not affect proliferation and apoptosis but modulates integrin-mediated adhesion to fibronectin, and C) SDF-1 induces secretion of VEGF, but not of MMPs or TIMPs. Thus the role of SDF-1 relates primarily to the interaction of lymphohematopoietic cells with their microenvironment and does not directly influence their proliferation or survival. We conclude that perturbation of the SDF-1-CXCR4 axis during HIV infection may affect interactions of hematopoietic cells with the hematopoietic microenvironment.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stromal-derived factor-1(SDF-1), a member of the family of {alpha}-chemokines, binds to the seven-span transmembrane G-protein-coupled CXCR4 receptor [1, 2] and competes with T-tropic HIV (X4 HIV) for binding to CXCR4 [3-7]. Members of the ß-chemokine family such as macrophage inflammatory protein 1ß (MIP-1ß), MIP-1{alpha}, and RANTES bind to the CCR5 chemokine receptor and compete with M-tropic HIV (R5 HIV). SDF-1 is a chemotactic factor for human hematopoietic progenitor CD34+ cells and plays an important role in the homing of these cells in the bone marrow [8-10]. SDF-1 stimulation of hematopoietic cells activates several intracellular signaling pathways [10-15], and the SDF-1-CXCR4 axis has been implicated in the regulation of proliferation and/or survival of these cells [16-18]. Recently we reported that stimulation of the X4 HIV-related chemokine receptor CXCR4 by SDF-1 stimulates phosphorylation of MAPK p42/44 and activation of the phosphatidylinositol (PI)-3K-AKT axis in normal human CD34+ cells and megakaryoblasts [11-12]. To our surprise, however, activation of MAPK p42/44 and the PI-3K-AKT axis did not influence proliferation or apoptosis but SDF-1 stimulated chemotaxis, adhesion, and production of VEGF and MMP-9 in these cells [11].

To clarify whether SDF-1 stimulates proliferation of various T- and B-lymphoid or myeloid cells and/or increases their survival, and to learn more about the role of HIV-related chemokine receptor-chemokine axes in human hematopoiesis, we investigated the functionality of CXCR4 and CCR5 receptors in 26 human myeloid, T-, and B-lymphoid cell lines selected on the basis of their expression of these receptors (designated as CXCR4+, CCR5+, and CXCR4+CXCR5+ cell lines). We evaluated the phosphorylation of MAPK p42/44, AKT, and STAT proteins and the ability of SDF-1 and MIP-1ß to influence cell growth, inhibit apoptosis, activate integrins and stimulate the production of vascular endothelial growth factor (VEGF), matrix metalloproteinases (MMP)s, and tissue inhibitors (TIMPs) by these cells.

We found that in these lymphohematopoietic cells: A) the CXCR4-SDF-1 axis is more functional in lymphohematopoiesis in comparison to the CCR5-MIP-1ß axis; B) SDF-1 activates the MAPK p42/44 pathway and the PI-3K-AKT axis; however, activation of these pathways does not affect either cell proliferation or apoptosis, and C) SDF-1 stimulates secretion of VEGF and adhesion to fibronectin but does not induce MMP or stimulate TIMP production in these cell lines. Thus the role of SDF-1 in lymphohematopoietic cells is primarily related to regulation of their interactions with the hematopoietic microenvironment.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Lines
The HL-60 and Jurkat hematopoietic cell lines were purchased from ATCC (Rockville, MD; http://www.atcc.org). Another 24 hematopoietic cell lines were the generous gift of Dr. M. Wasik, University of Pennsylvania and Dr. L. Silberstein, Harvard Medical School. All 26 myeloid and lymphoid cell lines employed in these studies were cultured in RPMI medium (GIBCO BRL; Long Island, NY) supplemented with 10% bovine calf serum (BCS) (Hyclone; Logan, UT; http://www.hyclone.com) as described [19], and maintained in agreement with the guidelines for the characterization and publication of human malignant hematopoietic cell lines [20].

Cell Proliferation by MTT Assay
The MTT assay was performed according to the manufacturer's recommendations (Promega; Madison, WI). Briefly, cells were seeded in 96-well plates at 5 x 104/well in 100 µl of RPMI medium containing 0.5% bovine serum albumin (BSA), 2% BCS, or 10% BCS plus various concentrations of SDF-1ß (0, 1, 10, and 100 ng/ml). After 72 hours, 20 µl of CellTiter 96 Aqueous One Solution reagent were added to each well and plates were incubated for 3-4 hours. Subsequently, plates were read at 490 nm using an automated plate-reader [11].

Apoptosis Assays
Apoptosis was assessed by staining with fluorescein isothiocyanate (FITC)-Annexin V and flow cytometric analysis (FACScan, Becton Dickinson; Mountain View, CA; http://www.bd.com) and by the apoptosis detection kit (R&D Systems; Minneapolis, MN; http://www.rndsystems.com) used according to the manufacturer's protocol. Activation of caspase-3 and poly(ADP-ribose) polymerase (PARP) cleavage was determined by fluorescence-activated cell sorting (FACS) and Western blot, respectively, according to the manufacturer's protocols (Becton Dickinson and PharMingen; San Diego, CA; http://www.pharmingen.com).

Evaluation of Adhesion Molecules
The expression of adhesion molecules on human lymphohematopoietic cells was evaluated by FACS. Cells were stained with specific anti-PECAM-1, ICAM-1, VCAM-1, E-selectin, very late acting antigen-5 (VLA-5) and VLA-4 antibodies detected with PE-conjugated secondary phycoerythrin (PE)-goat anti-mouse monoclonal antibodies (mAbs) as described previously [21-24]. The following antibodies were used for this study: 4G6 (IgG2b, mouse anti-human PECAM-1) generously provided by Dr. Steven Albelda [21]; R6.5 (BIRR-1), a murine IgG2a mAb directed against extracellular domain 2 of the ICAM-1 molecule, provided by Boehringer Ingelheim Pharmaceuticals Inc., Ridgefield, CT; http://www.boehringer-ingelheim.com [22]; 4B9, an IgG1 mAb directed against human VCAM-1, kindly provided by Dr. Roy Lobb, Biogen Inc., Cambridge MA; http://www.biogen.com [23], and ES2, (IgG1-k mouse anti-human-E-selectin mAb), generously provided by Dr. Rodger McEver, University of Oklahoma; Tulsa, OK [24].

Adhesion Assays
Adherence assays of hematopoietic cells were performed as described [11, 25, 26]. Briefly, 96 microtiter plates (Dynatech Labs; Chantilly, VA) covered with fibronectin were incubated for 30 minutes at 37°C in lymphocyte suspension buffer in the absence or presence of SDF-1 (500 ng/ml). Cell suspensions (100 µl) were applied to the wells and incubated for 1 hour at 37°C. The number of adherent cells was estimated by employing the colorimetric phosphate assay as described previously [11, 25, 26].

MMP and TIMP Evaluation
Lymphoma cell lines (JIM-1, NALM-6, 697, RS11846, RS911, HUT102B, C91PL, 2A, Sez-4, and PB-1) were incubated in serum-free RPMI (2-4 x 106 cells/ml) at 37°C in 5% CO2 for 24-48 hours with or without SDF-1 (100 ng/ml). After the incubation period, cell-conditioned media were collected for zymographic analysis of MMP-9 and MMP-2 activities and reverse zymographic analysis of TIMP-1 and TIMP-2 while the pellets were used for total RNA isolation and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis as described previously [27, 28]. Zymography was carried out using 12% polyacrylamide gel copolymerized with 1.5 mg/ml gelatin (Sigma; St. Louis, MO; http://www.sigma-aldrich.com) and clear bands at 92 kDa and 72 kDa against a Coomassie blue background indicated the presence of MMP-9 and MMP-2, respectively. Reverse zymography was performed using 12% polyacrylamide containing 1.75 mg/ml gelatin and 160 ng/ml recombinant MMP-2 (Oncogene Research Products; Cambridge, MA), and dark blue bands against a clear background indicated TIMP activity. Total cellular RNA was isolated using TRIZOL (GIBCO BRL; Gaithersburg, MD). The conversion of mRNA to cDNA was done using RT (AMVRT, MJS Biolynx; Brockville, ON, Canada; http://www.biolynx.ca) and the PCR using Taq DNA polymerase (GIBCO BRL; Long Island, NY) following the primer-dropping method. Sequences for human MMP-2, MMP-9, TIMP-1, TIMP-2, and GAPDH were obtained from GenBank (Los Alamos, NM) and used to design primer pairs. The primers used were as follows: MMP-2: 5'-primer, 5'GGCCCTGTCACTCCTGAGAT; 3'-primer, 5'GGCATC-CAGGT- TATCGGGGA; MMP-9: 5'-primer, 5'CAACATCACCTATTGGATCC; 3'-primer, 5'CGGGTGTAGAGTC TCTCGCT; TIMP-1: 5'-primer, 5'GCGGATCCAGCGCCCACACACAGACACC; 3'-primer, 5'TTAAGCTTCCACTC- CGGGGCAGATT; TIMP-2: 5'-primer, 5'GGCGTTTTGCAATGCAGATGTAG; 3'-primer, 5'CACAGGAGCCGTCACTTCTCTTG; and GAPDH: 5'-primer, 5'CGGAGTCA- ACGGATTTGGTCGTAT; 3'-primer, 5'AGCCTTCTCCATGGTTGGTGAAGAC. Thermocycling was performed with an Eppendorf Mastercycler personal thermocycler (Westbury, NY) at the optimum cycle number for each primer. PCR products were electrophoresed through 2% agarose gels containing 0.1 µg/µl ethidium bromide. Gels were visualized under UV light and photographed using the Kodak DC120 zoom digital camera (Eastman Kodak Co.; Rochester, NY).

VEGF Enzyme-Linked Immunosorbent Assay (ELISA)
Secretion of VEGF by human hematopoietic cell lines was evaluated by the Quantikine human VEGF immunoassay (R&D Systems) according to the manufacturer's protocol as described [11].

Phosphorylation of Intracellular Pathway Proteins
Western blots were done on extracts prepared from hematopoietic cell lines (1 x 107 cells) which were kept in RPMI medium containing low levels of BSA (0.5%) to render the cells quiescent. The cells were then divided and stimulated with optimal doses of SDF-1{alpha} or SDF-1ß (500 ng/ml) or thrombopoietin (TPO) (100 ng/ml) for 1 minute-2 hours at 37°C, and then lysed (for 10 minutes) on ice in M-Per lysing buffer (Pierce; Rockford, IL) containing protease and phosphatase inhibitors (Sigma). Subsequently, the extracted proteins were separated on either a 12% or 15% SDS-PAGE gel and the fractionated proteins transferred to a nitrocellulose membrane (Schleicher & Schuell; Keene, NH) as previously described [11, 12, 29]. Phosphorylation of each of the intracellular kinases, 44/42 MAPK (Thr 202/Tyr 204), p38 MAPK, AKT, and STAT-1, -3, -5, and -6 was detected using commercial mouse phospho-specific mAb (p44/42) or rabbit phospho-specific polyclonal antibodies for each of the remainder (all from New England Biolabs; Beverly, MA) with horseradish peroxidase-conjugated goat anti-mouse IgG or goat anti-rabbit IgG as a secondary antibody (Santa Cruz Biotech; Santa Cruz, CA; http://www.scbt.com) as described [11, 12, 29]. Equal loading in the lanes was evaluated by stripping the blots and reprobing with appropriate mAbs: p42/44 anti-MAPK antibody clone #9102, anti-AKT antibody clone #9272, anti-STAT 3 #9132 (New England Biolabs; http://www.neb.com/), anti-STAT 1 #sc-464, and STAT 6 #sc-1689 (Santa Cruz Biotech) and anti-STAT 5 #89 (Transduction Laboratories; Lexington, KY). The membranes were developed with an ECL reagent (Amersham Life Sciences; Little Chalfont, UK), dried, and subsequently exposed to film (HyperFilm, Amersham). Densitometric analysis was performed using exposures that were within the linear range of the densitometer (Personal Densitometer SI, Molecular Dynamics; Sunnyvale, CA) and ImageQuant software (Molecular Dynamics).

Statistical Analysis
Arithmetic means and standard deviations were calculated on a Macintosh computer using Instat 1.14 (GraphPad; San Diego, CA; http://www.graphpad.com) software. Data were analyzed using the Student t-test for unpaired samples. Statistical significance was defined as p < 0.05.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stimulation of CXCR4+ Cell Lines by SDF-1 Results in Phosphorylation of MAPK p42/44 and AKT
Previously we reported that several human hematopoietic cell lines expressed the HIV-related chemokine receptors CXCR4 and CCR5 [19]. In our current study, we selected 26 human CXCR4+, CXCR4+CCR5+, and CCR5+ cell lines to study whether CXCR4 and CCR5 receptors and their specific ligands, SDF-1 and MIP-1ß, respectively, activate signal transduction pathways pertinent to the regulation of cell proliferation and apoptosis such as MAPK p42/44, PI-3K-AKT, STAT-1, -3, and -5. The cell lines were first made quiescent by serum deprivation and subsequently stimulated by SDF-1 and MIP-1ß (Tables 1-3GoGoGo). We found that MAPK p42/44 and AKT were constitutively activated in some of these cell lines: MAPK p42/44 was constitutively phosphorylated in Sez4, 697, DAUDI, YT, and HL-60 cells (Table 1Go; Fig. 1Go, panel A) and AKT in L428, HS Sultan, DAUDI, YT, Jurkat, MOLT4, 20A, 15A, and SUDHL-6. Addition of SDF-1 did not affect the phosphorylation status of these proteins (Table 2Go; Fig. 1Go, panel B).


View this table:
[in this window]
[in a new window]
 
Table 1. Phosphorylation of MAPK p42/44 (Thr 202/Tyr 204) in CXCR4+, CXCR4+CCR5+, and CCR5+ cell lines after stimulation with SDF-1 or MIP-1ß
 

View this table:
[in this window]
[in a new window]
 
Table 2. Phosphorylation of AKT in CXCR4+, CXCR4+CCR5+, and CCR5+ cell lines after stimulation with SDF-1 or MIP-1ß
 

View this table:
[in this window]
[in a new window]
 
Table 3. Tyrosine phosphorylation of STAT-1, STAT-3, and STAT-5 in CXCR4+, CXCR4+CCR5+, and CCR5+and cell lines after stimulation with SDF-1 or MIP-1ß
 


View larger version (48K):
[in this window]
[in a new window]
 
Figure 1. Constitutive phosphorylation of MAPK p42/44 (left panel) and AKT (right panel) in selected hematopoietic cell lines. Lane 1: cells made quiescent by serum deprivation; lane 2: cells stimulated with SDF-1 for 2 minutes, and lane 3: for 10 minutes. A representative study out of three is shown. Panel A = HL-60, panel B = DAUDI, panel C = YT, panel D = Jurkat, panel E = MOLT4, and panel F = 15A.

 
In all the other CXCR4+CCR5+ or CXCR4+ cell lines (PB-1, 2A, C91PL, L428, HS Sultan, RS11846, ATL-2, Jurkat, HUT102B, MOLT4, JIM-1, NALM-6, 20A, 15A, RS911, and SUDHL-6), MAPK p42/44 became phosphorylated after stimulation with SDF-1 (Table 1Go; Fig. 2Go). Similarly, AKT was phosphorylated in 10 of 12 CXCR4+ CCR5+ or CXCR4+ cell lines (PB-1, 2A, Sez4, C91PL, 697, RS11846, HUT102B, JIM-1, NALM-6, and RS911) (Table 2Go; Fig. 3Go), the exceptions being ATL-2 and HL-60 cells. Hence, SDF-1 activated MAPK p42/44 in all, and AKT in 85%, of the CXCR4+ cell lines selected for this study.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 2. Phosphorylation of MAPK p42/44 in selected hematopoietic cell lines. Left panel: CXCR4+CCR5+ cell lines: lane 1: cells made quiescent by serum deprivation; lane 2: cells stimulated with MIP-1ß for 2 minutes; lane 3: cells stimulated with MIP-1ß for 10 minutes; lane 4: cells stimulated with SDF-1 for 2 minutes; lane 5: cells stimulated with SDF-1 for 10 minutes. Right panel: CXCR4+ cell lines: lane 1: cells made quiescent by serum deprivation; lane 2: cells stimulated with SDF-1 for 2 minutes; lane 3: cells stimulated with SDF-1 for 10 minutes. Panel A = PB-1, panel B = C19PL, panel C = 2A, panel D = RS11846 cells, panel E = MOLT4, panel F = Jurkat, panel G = JIM-1, panel H = 20A. A representative study out of three is shown.

 


View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Phosphorylation of AKT in selected hematopoietic cells lines. Left panel: CXCR4+CCR5+ cell lines: lane 1: cells made quiescent by serum deprivation; lane 2: cells stimulated with MIP-1ß for 2 minutes; lane 3: cells stimulated with MIP-1ß for 10 minutes; lane 4: cells stimulated with SDF-1 for 2 minutes; lane 5: cells stimulated with SDF-1 for 10 minutes. Panel A = C19PL, panel B = 697, panel C = 2A. Right panel: CXCR4+ cell lines: lane 1: cells made quiescent by serum deprivation; lane 2: cells stimulated with SDF-1 for 2 minutes; lane 3: cells stimulated with SDF-1 for 10 minutes. Panel D: HUT102B, panel E: JIM-1, panel F: RS911. A representative study out of three is shown.

 
In contrast, MIP-1ß stimulated MAPK p42/44 only in 3 (HS Sultan, DAMI, and HEL) of 15 CCR5+ or CCR5+CXCR4+ cell lines as shown in Table 1Go and Figure 4Go and AKT phosphorylation in none of them (Table 2Go).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 4. Phosphorylation of MAPK p42/44 in CCR5+ selected hematopoietic cells lines. Panel A = HS Sultan: lane 1: cells made quiescent by serum deprivation; lane 2: cells stimulated with MIP-1ß for 2 minutes; lane 3: cells stimulated with MIP-1ß for 10 minutes; lane 4: cells stimulated with SDF-1 for 2 minutes; lane 5: cells stimulated with SDF-1 for 10 minutes. Panel B = HEL: lane 1: cells made quiescent by serum deprivation; lane 2: cells stimulated with MIP-1ß for 2 minutes; lane 3: cells stimulated with MIP-1ß for 10 minutes. A representative study out of three is shown.

 
Stimulation of CXCR4+ and/or CCR5+ Cell Lines with SDF-1 or MIP-1ß Does Not Result in Phosphorylation of STAT Proteins
We also found that in PB-1, 2A, L428, RS11846, JB-6, DAUDI, ATL-2, HUT102B, 20A, and 15A cell lines STAT-1, -3, and -5 proteins are constitutively phosphorylated (Table 3Go). We noticed that except for the L428 cell (Hodgkin's disease), the status of phosphorylation of STAT-1, -3, and -5 proteins at tyrosine residues did not change after stimulation of CXCR4+ and/or CCR5+ cell lines with either SDF-1 or MIP-1ß (Table 3Go). This finding is consistent with our previous observations of normal human megakaryoblasts [11].

Phosphorylation of MAPK p42/44 by SDF-1 or MIP-1ß Does Not Affect Cell Proliferation
It has been postulated that the phosphorylation of MAPK p42/44 plays an important role in regulating cell proliferation [30, 31]. In this study we examined whether SDF-1 stimulates the growth of the 16 cell lines (Table 1Go) we found to respond positively to stimulation with SDF-1 by phosphorylation of MAPK p42/44. Using the colorimetric MTT assay, cell proliferation was evaluated 72 hours after stimulation by SDF-1. SDF-1 (1-100 ng/ml) had no effect on proliferation of these cells regardless of whether the cell lines were cultured in media containing 10% or 2% BCS and 0.5% BSA. A representative experiment is shown in Figure 5Go. MIP-1ß did not influence the proliferation of HS Sultan and HEL cells, either; however, MAPK p42/44 was phosphorylated after stimulation of these cells by MIP-1ß (Fig 4Go).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. Influence of SDF-1 (0-100 ng/ml) on proliferation of selected hematopoietic cell lines by MTT colorimetric assay. The cells were stimulated by SDF-1 in medium supplemented with 0.5% BSA (left panels) or 2% BCS (right panels). The experiment was repeated four times. Panel A = B-lymphocytic cell lines (NALM-6, RS911 and 15A). Panel B = T-lymphocytic cell lines (Jurkat, MOLT-4, and HUT102B).

 
Phosphorylation of AKT by SDF-1 Does Not Affect Cell Survival
It has been suggested that the PI-3K-AKT axis may regulate survival of hematopoietic cells [32-35]. Hence, we set out to determine whether phosphorylation of AKT by stimulation with SDF-1 protects human lymphohematopoietic cell lines from apoptosis. For this study, we selected cell lines (Table 2Go) that responded to SDF-1 stimulation by activation of AKT. Apoptosis was induced by culturing hematopoietic cells in 0.5% BSA either with or without SDF-1, or by irradiating these cells by 1,000-2,000 cGy in the presence or absence of SDF-1. The number of apoptotic cells was evaluated by the Annexin-V binding assay, presence of activated intracellular caspase-3, and cleavage of PARP. We found that lymphohematopoietic cells spontaneously underwent apoptosis after prolonged culture in medium supplemented with 0.5% BSA or after {gamma}-irradiation and that the addition of SDF-1 to media did not improve the survival of serum-starved cells (data not shown) or {gamma}-irradiated cells (Figs. 6, 7GoGo). Representative data show Annexin-V binding (Fig. 6Go, panel A), caspase-3 activation (Fig. 6Go, panel B) and PARP cleavage (Fig. 6Go, panel C) in cells that were {gamma}-irradiated and cultured in the absence or presence of SDF-1. Apoptosis was induced by {gamma}-irradiation in JIM-1, NALM-6, and RS911 B-lymphoid cell lines, and the survival of irradiated cells was not improved by the presence of SDF-1 in the culture media (Fig. 6Go). Similarly, as shown in Figure 7Go, {gamma}-irradiation induced apoptosis in PB-1 and 2A T-lymphoid cells and, again, survival of these cells was not affected. Of note, while {gamma}-irradiation increased the number of Annexin V binding cells in the 2A cell line (an early sign of apoptosis) (Fig. 7Go, right panel), activation of caspase-3 and consequently PARP cleavage was somewhat delayed in this cell line as compared with PB-1 cells (Fig. 7Go, left panel).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 6. Detection of apoptosis in selected B-lymphocytic cell lines (JIM-1, NALM-6, RS911). Cells were {gamma}-irradiated and cultured in the absence (upper panels) or presence (lower panels) of SDF-1 (300 ng/ml). The experiment was repeated twice. Unshaded histograms show cells that have not been induced to undergo apoptosis. Panel A = Annexin-V staining. Panel B = detection of activated caspase-3 by intracellular staining with antibody which recognizes activated caspase-3. Panel C = PARP cleavage (left lanes: non-irradiated cells; middle lanes: irradiated cells cultured for 24 hours without SDF-1; right panels: irradiated cells cultured for 24 hours with 300 ng/ml of SDF-1).

 


View larger version (28K):
[in this window]
[in a new window]
 
Figure 7. Detection of apoptosis in selected T-lymphocytic cell lines (PB-1 and 2A). Cells were {gamma}-irradiated and cultured in the absence (upper panels) or presence (lower panels) of SDF-1 (300 ng/ml). The experiment was repeated twice. Unshaded histograms show cells that have not been induced to undergo apoptosis. Panel A = Annexin-V staining. Panel B = detection of activated caspase-3 by intracellular staining with antibody which recognizes activated caspase-3. Panel C = PARP cleavage (left lanes: irradiated cells cultured for 24 hours without SDF-1; right panels: irradiated cells cultured for 24 hours with 300 ng/ml of SDF-1).

 
SDF-1 Does Not Influence the Expression of Adhesion Molecules But Regulates Integrin Function
Previously we reported that stimulation of human hematopoietic cells by SDF-1 activates NF-{kappa}B in a PI-3K-AKT-dependent manner [11] and, since NF-{kappa}B binding sites are present in the promoters of several adhesion molecules [36, 37], in this study we investigated whether SDF-1 regulates expression of these proteins on the cell surface. We phenotyped the cell lines that responded to stimulation by SDF-1 (Tables 1, 2GoGo) for expression of PECAM-1, ICAM-1, VCAM-1, E-selectin, VLA-5, and VLA-4. We demonstrated that several of these molecules are expressed on these lymphohematopoietic cell lines (Table 4Go) but, to our surprise, SDF-1 stimulation did not affect the level of their expression (data not shown), indicating that SDF-1 does not play a role in regulating their cell surface expression. Moreover, since we and others reported that SDF-1 may regulate the function of several integrins on normal human hematopoietic cells [14], we selected eight cell lines from among the VLA-4+ and VLA-5+ cell lines (Table 4Go) and investigated whether SDF-1 regulates their adhesion to fibronectin. We found that SDF-1 significantly increased adhesion to fibronectin in two B-lymphocytic cell lines (RS11846) as well as three T-lymphocytic cell lines (Jurkat, PB-1, and 2A) (Fig. 8Go). Since 2A cells did not express VLA-4 on their surface, we assumed that the binding of 2A cells to the fibronectin is most probably regulated by other members of the integrin family.


View this table:
[in this window]
[in a new window]
 
Table 4. FACS analysis of expression of selected adhesion molecules on human lymphohematopoietic CXCR4+ cell lines. Experiment was repeated twice with similar results.*
 


View larger version (33K):
[in this window]
[in a new window]
 
Figure 8. Adhesion of PB-1, Jurkat, RS11846, and 2A cells to fibronectin in the presence or absence of SDF-1. The experiment was repeated three times. A representative study is demonstrated.

 
SDF-1 Induces VEGF Secretion in Lymphohematopoietic Cell Lines
We reported recently that SDF-1 induces secretion of VEGF and MMPs in a PI-3K-AKT-NF{kappa}B axis-dependent manner in normal human megakaryoblasts [11]. As both VEGF and MMP-9 proteins play a role in cell migration [11, 27, 28, 38-40] and cellular interactions with endothelium, we asked whether a similar mechanism operates in cells derived from T- and B-lymphoid lineages. Cells were made quiescent and subsequently stimulated or not (control) with SDF-1. The VEGF levels in media conditioned by cells in the absence or presence of SDF-1 are shown in Table 5Go. We found that VEGF was constitutively secreted by all cell lines except NALM-6, and secretion was upregulated by SDF-1 stimulation in eight of the nine cell lines evaluated. VEGF secretion was enhanced up to 10-fold in C19PL, threefold in Jurkat and RS11846, and two-fold in 2A and PB-1 cell lines as compared with unstimulated cells (Table 5Go).


View this table:
[in this window]
[in a new window]
 
Table 5. Secretion of VEGF by cells stimulated with SDF-1
 
SDF-1 Does Not Induce MMP or TIMP Secretion in Lymphohematopoietic Cell Lines
In contrast to normal human myeloid cells [28, 38] as well as leukemic blasts derived from patients suffering from acute myeloid leukemia [27], we did not find mRNA expression of MMP-9 or MMP-2 in the T- and B- cell lines studied, with the exception of Sez-4, which expressed MMP-2; SDF-1 did not stimulate it any further (Fig. 9Go). Moreover, stimulation of these cells by SDF-1 did not have any effect on either expression of MMP-2 or MMP-9 (Fig. 9Go) or their secretion (not shown). TIMP-1 was constitutively expressed by NALM 6, RS911, Sez-4, HUT102B, 2A, 697, JIM-1, and RS11846 but was not stimulated by SDF-1. These cell lines also constitutively expressed TIMP-2 except for HUT102B, 2A, and RS11846 (Fig. 9Go).



View larger version (70K):
[in this window]
[in a new window]
 
Figure 9. RT-PCR analysis of mRNA transcripts for MMP-2, MMP-9, TIMP-1, and TIMP-2 in lymphoid cell lines incubated in the absence (control, C) or presence of 100 ng/ml SDF-1. GAPDH was used as the internal control.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SDF-1 has been reported to be a growth factor for stromal cell-dependent B-lineage cells [1, 2]. It has also been shown that SDF-1, which is secreted by blood-derived nurse-like cells, protects chronic lymphocytic leukemia B cells from spontaneous apoptosis [41]. Nevertheless, the role of SDF-1 in proliferation and survival of human lymphohematopoietic cells is somewhat controversial [11, 12, 16-18, 42-44]. While SDF-1 has been shown to stimulate proliferation of murine megakaryocytic progenitors as well as human peripheral blood CD34+ cells [17, 18], we did not find any stimulatory effect on human bone marrow-derived CD34+ cells or megakaryocytic progenitors [11, 12]. On the other hand, as shown by us and others, SDF-1 stimulated both the MAPK p42/44 [11, 12, 15, 29] and PI-3K-AKT axes in human hematopoietic cells [11, 12, 15, 29], and both of these pathways have been postulated to play a role in regulating proliferation and survival of human hematopoietic cells [30-35].

To further address the question of whether SDF-1 regulates proliferation and/or survival of human lymphohematopoietic cells, we selected CXCR4+ cell lines which responded to stimulation by SDF-1 by phosphorylation of MAPK p42/44 and/or AKT and we found that MAPK p42/44 became phosphorylated in all the cell lines studied, and AKT in 85%. In contrast, we demonstrated that in CCR5+ cell lines, the CCR5 specific ligand MIP-1ß stimulated phosphorylation of MAPK p42/44 in only 20%, and of AKT in none of the cell lines studied. Thus, these results are consistent with our previous calcium flux and chemotaxis investigations, indicating that in human hematopoietic cells the CXCR4 receptor is more functional than the CCR5 receptor [11, 12, 29].

Although in our human lymphohematopoietic cell lines both the MAPK p42/44 and PI-3K-AKT axes were activated by SDF-1, none of them responded to SDF-1 stimulation with increased proliferation and/or reduced apoptosis. This could suggest that activation of other parallel or downstream signaling pathways/proteins (not activated by the SDF-1-CXCR4 axis) may be important for stimulating proliferation and/or inhibiting apoptosis in lymphohematopoietic cells.

Recently we showed activation of STAT proteins after stimulation with TPO but not with SDF-1, which explains why thrombopoietin, but not SDF-1, stimulates proliferation and inhibits apoptosis in normal human megakaryoblasts [11]. Significant experimental evidence suggests that STAT proteins are involved both in stimulation of proliferation [45-47] and inhibition of apoptosis [48]. For example, STAT-5 has been found to regulate expression of the antiapoptotic bcl-xl protein in hematopoietic cells, and STAT protein binding sites have been shown in the promoters of several antiapoptotic genes [48]. However, in this study of 26 human lymphohematopoietic cell lines, except for L428 (Hodgkin's disease) STAT proteins were not phosphorylated at tyrosine residues after stimulation with either SDF-1 or MIP-1ß. Hence, we suggest that in human normal as well as malignant hematopoietic cells, STAT proteins are not primary targets for chemokine signaling.

Interestingly, in certain of the cell lines studied we found that some STAT proteins are activated constitutively, but that additional costimulation of these cells with SDF-1, although resulting in activation of MAPK p42/44 and/or AKT in these cells, did not affect their proliferation or survival. Hence, we postulate that the regulatory role of SDF-1 is not concerned with stimulating either proliferation or survival of lymphohematopoietic cells [11, 12, 19, 43, 49].

In contrast, we found that SDF-1 activates integrins and stimulates secretion of VEGF by these cells. These data are in agreement with our previous studies performed on normal human megakaryoblasts [11]. Activation of integrins and VEGF secretion are crucial in regulating the interactions of hematopoietic cells with endothelial and stromal cells. Whereas VEGF activates endothelial cells and stimulates angiogenesis, integrins regulate adhesion of hematopoietic cells to the fibronectin and other ligands in the bone marrow microenvironment. Other factors which participate in cellular interactions and angiogenesis include MMPs. Various cytokines and chemokines were shown to induce MMP production in normal T cells [50], and we recently suggested that interleukin 6 stimulated the production of MMPs and may play a role in the development of lymphoid malignancies [51]. In this study, the majority of the cell lines of T- and B-lymphoid origin did not express or secrete MMP-9 and MMP-2, and SDF-1 had no effect on their expression as it did in normal human megakaryoblasts and CD34+ progenitor cells [11, 38]. On the other hand, we found that all the lymphoid cell lines studied (JIM-1, NALM-6, 697, RS11846, RS911, HUT102B, 2A, and Sez-4) expressed MMP inhibitors (TIMP-1 and/or TIMP-2) but, again, SDF-1 did not affect TIMP expression as it did in peripheral blood CD34+ cells [38]. This suggests that in lymphoid cells, regulation of MMPs and TIMPs may operate by mechanisms other than those occurring in cells of myeloid origin.

We believe that these studies may shed light on certain processes taking place during HIV infection as several HIV envelope proteins as well the HIV tat protein have been reported to affect the biological function of the SDF-1-CXCR4 axis [52]. We suggest that the blockage of the CXCR4 receptor by such proteins could perturb the interaction of lymphoid cells with their microenvironment. Such perturbation of the CXCR4-SDF-1 axis may lead to altered interaction of lymphoid cells with their physiological microenvironment in various lymphohematopoietic organs. Perturbation of adhesion may decrease signaling from integrin receptors [15], leading to a decrease in cell survival by the anoikis-dependent mechanism [53]. We are currently investigating this latter possibility in our laboratory.

Based on these and our other observations [11, 12, 19, 38], we conclude that SDF-1 is an important factor regulating the interaction of lymphohematopoietic cells with the microenvironment but is not primarily involved in regulating proliferation or survival of these cells.


    ACKNOWLEDGMENT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This work was supported by NIH grant R01HL61796-01 to MZR and CBS grant XE0004 to AJW.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nagasawa T, Hirota S, Tachibana K et al. Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 1996;382:635–638.[CrossRef][Medline]

  2. Zou Y, Kottmann AH, Kuroda M et al. Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 1998;393:595–599.[CrossRef][Medline]

  3. Rollins BJ. Chemokines. Blood 1997;90:909–928.[Free Full Text]

  4. Fauci AS. Host factors and the pathogenesis of HIV-induced disease. Nature 1996;384:529–534.[CrossRef][Medline]

  5. Moses A, Nelson J, Bagby GC. The influence of human immunodeficiency virus-1 on hematopoiesis. Blood 1998;91:1479–1495.[Free Full Text]

  6. Cairns JS, D'Souza MP. Chemokines and HIV-1 second receptors: the therapeutic connection. Nat Med 1998;4:563–568.[CrossRef][Medline]

  7. Lee B, Ratajczak J, Doms RW et al. Coreceptor/chemokine receptor expression on human hematopoietic cells: biological implications for HIV-1 infection. Blood 1999;93:1145–1156.[Abstract/Free Full Text]

  8. Mohle R, Bautz F, Rafii S et al. The chemokine receptor CXCR4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell-derived factor-1. Blood 1998;91:4523–4530.[Abstract/Free Full Text]

  9. Aiuti A, Webb IJ, Bleul C et al. The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood. J Exp Med 1997;185:111–120.[Abstract/Free Full Text]

  10. Dutt P, Wang JF, Groopman JE. Stromal cell-derived factor-1{alpha} and stem cell factor/kit ligand share signaling pathways in hemopoietic progenitors: a potential mechanism for cooperative induction of chemotaxis. J Immunol 1998;161:3652–3658.[Abstract/Free Full Text]

  11. Majka M, Janowska-Wieczorek A, Ratajczak J et al. Stromal derived factor-1 and thrombopoietin regulate distinct aspects of human megakaryopoiesis. Blood 2000;96:4142–4151.[Abstract/Free Full Text]

  12. Majka M, Ratajczak J, Lee B et al. The role of HIV related chemokine receptors and chemokines in human erythropoiesis in vitro. STEM CELLS 2000;18:128–138.[Abstract/Free Full Text]

  13. Ganju RK, Brubaker SA, Meyer J et al. The alpha-chemokine, stromal cell-derived factor-1{alpha}, binds to the transmembrane G-protein-coupled CXCR-4 receptor and activates multiple signal transduction pathways. J Biol Chem 1998;273:23169–23175.[Abstract/Free Full Text]

  14. Peled A, Grabovsky V, Habler L et al. The chemokine SDF-1 stimulates integrin-mediated arrest of CD34+ cells on vascular endothelium under shear flow. J Clin Invest 1997;104:1199–1211.[Medline]

  15. Wang J-F, Park I-W, Groopman JE. Stromal cell-derived factor-1{alpha} stimulates tyrosine phosphorylation of multiple focal adhesion proteins and induces migration of hematopoietic progenitor cells: roles of phosphoinositide-3 kinase and protein kinase C. Blood 2000;95:2505–2513.[Abstract/Free Full Text]

  16. Wang JF, Liu ZY, Groopman JE. The ß-chemokine receptor CXCR4 is expressed on the megakaryocytic lineage from progenitor to platelets and modulates migration and adhesion. Blood 1998;92:756–764.[Abstract/Free Full Text]

  17. Hodohara K, Fujii N, Yamamoto N et al. Stromal cell-derived factor-1 (SDF-1) acts together with thrombopoietin to enhance the development of megakaryocytic progenitor cells (CFU-MK). Blood 2000;95:769–775.[Abstract/Free Full Text]

  18. Lataillade J-J, Clay D, Dupuy C et al. Chemokine SDF-1 enhances circulating CD34+ cell proliferation in synergy with cytokines: possible role in progenitor survival. Blood 2000;95:756–768.[Abstract/Free Full Text]

  19. Majka M, Rozmyslowicz T, Honczarenko M et al. Biological significance of the expression of HIV related chemokine coreceptors (CCR5 and CXCR4) and their ligands by human hematopoietic cell lines. Leukemia 2000;14:1821–1832.[CrossRef][Medline]

  20. Drexler HG, Matsuo Y. Guidelines for the characterization and publication of human malignant hematopoietic cell lines. Leukemia 1999;13:835–842.[CrossRef][Medline]

  21. Christofidou-Solomidou M, Nakada M, Williams J et al. Neutrophil platelet endothelial cell adhesion molecule-1 participates in neutrophil recruitment at inflammatory sites and is down-regulated after leukocyte extravasation. J Immunol 1997;158:4872–4878.[Abstract]

  22. Vuorte J, Lindsberg PJ, Kaste M et al. Anti-ICAM-1 monoclonal antibody R6.5 (Enlimomab) promotes activation of neutrophils in whole blood. J Immunol 1999;162:2353–2357.[Abstract/Free Full Text]

  23. Carlos TM, Schwartz BR, Kovach NL et al. Vascular cell adhesion molecule-1 mediates lymphocyte adherence to cytokine-activated cultured human endothelial cells. Blood 1990;76:965–970.[Abstract/Free Full Text]

  24. McEver RP, Martin MN. A monoclonal antibody to a membrane glycoprotein binds only to activated platelets. J Biol Chem 1984;259:9799–9804.[Abstract/Free Full Text]

  25. Bellavite P, Andrioli G, Guzzo P et al. A colorimetric method for the measurement of platelet adhesion in microtiter plates. Anal Biochem 1994;216:444–450.[CrossRef][Medline]

  26. Loh E, Beaverson K, Vilaire G et al. Agonist-stimulated ligand binding by the platelet integrin aIIbb3+ cells in a lymphocyte expression system. J Biol Chem 1995;270:18631–18636.[Abstract/Free Full Text]

  27. Janowska-Wieczorek A, Marquez LA, Matsuzaki A et al. Expression of matrix metalloproteinases (MMP-2 and -9) and tissue inhibitors of metalloproteinases (TIMP-1 and -2) in acute myelogenous leukaemia blasts: comparison with normal bone marrow cells. Br J Haematol 1999;105:402–411.[CrossRef][Medline]

  28. Janowska-Wieczorek A, Marquez LA, Nabholtz J-M et al. Growth factors and cytokines upregulate gelatinase expression in bone marrow CD34+ cells and their transmigration through reconstituted basement membrane. Blood 1999;93:3379–3390.[Abstract/Free Full Text]

  29. Majka M, Ratajczak J, Kowalska MA et al. Binding of stromal derived factor-1{alpha} (SDF-1{alpha}) to CXCR4 chemokine receptor in normal human megakaryoblasts but not in platelets induces phosphorylation of mitogen-activated protein kinase p42/44 (MAPK), ELK-1 transcription factor and serine/threonine kinase AKT. Eur J Haematol 2000;64:164–172.[CrossRef][Medline]

  30. Gutkind JS. The pathways connecting G protein-coupled receptors to the nucleus through divergent mitogen-activated protein kinase cascades. J Biol Chem 1998;273:1839–1842.[Free Full Text]

  31. Rojnuckarin P, Drachman JG, Kaushansky K. Thrombopoietin induced activation of the mitogen-activated protein kinase (MAPK) pathway in normal megakaryocytes: role in endomitosis. Blood 1999;94:1273–1282.[Abstract/Free Full Text]

  32. Khwaja A. Akt is more than just bad kinase. Science 1999;401:33–34.

  33. Kelley TW, Graham MM, Doseff AI et al. Macrophage colony-stimulating factor promotes cell survival through Akt/protein kinase B. J Biol Chem 1999;274:26393–26398.[Abstract/Free Full Text]

  34. Songyang Z, Baltimore D, Cantley LC et al. Interleukin-3 dependent survival by the Akt protein kinase. Proc Natl Acad Sci USA 1997;94:11345–11350.[Abstract/Free Full Text]

  35. Datta SR, Dudek H, Tao X et al. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 1997;91:231–241.[CrossRef][Medline]

  36. Ghosh S, May MJ, Kopp EB. NF-{kappa}B and rel proteins: evolutionarily conserved mediators of immune response. Annu Rev Immunol 1998;16:225–260.[CrossRef][Medline]

  37. Pan ZK, Christiansen SC, Ptasznik A et al. Requirement of phosphatidylinositol 3-kinase activity for bradykinin stimulation of NF-kb activation in cultured human epithelial cells. J Biol Chem 1999;274:9918–9922.[Abstract/Free Full Text]

  38. Janowska-Wieczorek A, Marquez LA, Dobrowsky A et al. Differential MMP and TIMP production by human marrow and blood CD34+ cells in response to chemokines. Exp Hematol 2000;28:1274–1285.[CrossRef][Medline]

  39. Hamada T, Mohle R, Hesselgesser J et al. Transendothelial migration of megakaryocytes in response to stromal cell-derived factor-1 (SDF-1) enhances platelet formation. J Exp Med 1998;188:539–548.[Abstract/Free Full Text]

  40. Naiyer AJ, Jo DY, Ahn J et al. Stromal derived factor-1-induced chemokinesis of cord blood CD34+ cells (long-term culture-initiating cells) through endothelial cells is mediated by E-selectin. Blood 1999;94:4011–4019.[Abstract/Free Full Text]

  41. Burger JA, Tsukada N, Burger M et al. Blood-derived nurse-like cells protect chronic lymphocytic leukemia B cells from spontaneous apoptosis through stromal cell-derived factor-1. Blood 2000;96:2655–2663.[Abstract/Free Full Text]

  42. Gibellini D, Bassini A, Re MC et al. Stroma-derived factor 1 alpha induces a selective inhibition of human erythroid development via the functional upregulation of Fas/CD95 ligand. Br J Haematol 2000;111:432–440.[CrossRef][Medline]

  43. Riviere C, Subra F, Cohen-Solal K et al. Phenotypic and functional evidence for the expression of CXCR4 receptor during megakaryocytopoiesis. Blood 1999;93:1511–1523.[Abstract/Free Full Text]

  44. Sanchez X, Cousins-Hodges B, Aguilar T et al. Activation of HIV-1 coreceptor (CXCR4) mediates myelosuppression. J Biol Chem 1997;272:27529–27531.[Abstract/Free Full Text]

  45. Blalock WL, Weinstein-Oppenheimer C, Chang F et al. Signal transduction, cell cycle regulatory, and anti-apoptotic pathways regulated by IL-3 in hematopoietic cells: possible sites for intervention with anti-neoplastic drugs. Leukemia 1999;13:1109–1166.[CrossRef][Medline]

  46. Drachman JG, Millett KM, Kaushansky K. Thrombopoietin signal transduction requires functional JAK2 not TYK2. J Biol Chem 1999;274:13480–13484.[Abstract/Free Full Text]

  47. Liu RY, Fan C, Garcia R et al. Constitutive activation of JAK2/STAT5 signal transduction pathway correlates with growth factor independence of megakaryocytic leukemic cell lines. Blood 1999;93:2369–2379.[Abstract/Free Full Text]

  48. Gesbert F, Griffin JD. Bcr/abl activates transcription of the Bcl-X gene through STAT5. Blood 2000;96:2269–2276.[Abstract/Free Full Text]

  49. Drexler HG, Zaborski M, Quentmeier H. Cytokine response profiles of human myeloid factor-dependent leukemia cell lines. Leukemia 1997;11:701–708.[CrossRef][Medline]

  50. Goetzl EJ, Banda MJ, Leppert D. Matrix metalloproteinases in immunity. J Immunol 1996;156:1–4.[Abstract]

  51. Kossakowska AE, Edwards DR, Prusinkiewicz C et al. Interleukin-6 regulation of matrix metalloproteinase (MMP-2 and MMP-9) and tissue inhibitor of metalloproteinase (TIMP-1) expression in malignant non-Hodgkin's lymphomas. Blood 1999;94:2080–2089.[Abstract/Free Full Text]

  52. Xiao H, Neuveut C, Tiffany HL et al. Selective CXCR4 antagonism by Tat: implications for in vivo expansion of coreceptor use by HIV-1. Proc Natl Acad Sci USA 2000;97:11466–11471.[Abstract/Free Full Text]

  53. Ruoslahti E, Reed JC. Anchorage dependence, integrins and apoptosis. Cell 1994;77:477–478.[CrossRef][Medline]

Received May 3, 2001; accepted for publication May 17, 2001.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kijowski, J.
Right arrow Articles by Ratajczak, M. Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kijowski, J.
Right arrow Articles by Ratajczak, M. Z.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS