|
|
||||||||
a Whitehead Institute, Cambridge, Massachusetts, USA;
b ViaCell, Inc., Cambridge, Massachusetts, USA;
c Division of Hematology/Oncology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, USA
Key Words. Embryonic stem cells • Hemangioblast • Thrombopoietin • c-Mpl
George Q. Daley, M.D., Ph.D., Whitehead Institute, 9 Cambridge Center, Cambridge, Massachusetts 02142, USA. Phone: 617-258-7209; Fax: 617-258-5213; e-mail: daley{at}wi.mit.edu
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In normal mice, c-Mpl is expressed in megakaryocytes, platelets, and primitive hematopoietic cells of fetal liver and BM [16, 17]. c-mpl expression can be found in a highly purified population of dormant HSCs [17], and it has been demonstrated that 70% of highly enriched populations of murine LinloSca+c-kit+ and human CD34+CD38- express c-mpl [18]. The same authors, using competitive repopulation assays, showed that the c-Mpl+ fraction contained all of the repopulating capacity in the murine system and almost all of the engraftment potential in a mouse-human xenograft model [18]. All these findings support the concept that c-Mpl plays an important role in the early stages of hematopoiesis. Interestingly, low levels of expression have also been detected in endothelial cells derived from the umbilical cord [16, 19] and more abundantly in liver endothelial cells [20].
The close association between endothelial cells and primitive hematopoietic precursors in the embryonic yolk sac suggests that the endothelium plays a critical role in early hematopoietic development, providing the microenvironment required for stem cell proliferation and differentiation. Endothelial and blood precursors also express several common critical regulatory genes and antigenic markers [2125]. These observations have led to the hypothesis that a common progenitor, the hemangioblast, gives rise to both endothelial and hematopoietic cells [26, 27]. Recently, a cell with properties of the hemangioblast has been identified during in vitro differentiation of embryonic stem (ES) cells into embryoid bodies (EBs) [28]. This precursor, referred to as the blast colony-forming cell (BL-CFC) forms in response to vascular endothelial growth factor (VEGF) and stem cell factor (SCF), and represents a transient population of cells that stand at the juncture of the endothelial and hematopoietic lineages [29].
Based on the role of TPO as a growth factor for early hematopoiesis, we hypothesized that TPO might have a similar effect on the hemangioblast. In this study, we demonstrated that TPO and its receptor are expressed at the yolk sac stage of hematopoiesis in the embryo, and that TPO stimulates hemangioblast formation during differentiation of ES cells in vitro. These data suggest a role for TPO at the earliest stages of hematopoietic development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Infection of ES cells with MSCVF36VmplGFP
We used a fusion protein composed of the c-Mpl receptor-signaling domain linked to a modified FK506-binding protein dimerization domain (F36V). In this system, activation of c-Mpl occurs through dimerization, which is controlled by adding a chemical inducer of dimerization (CID) [31, 32]. MSCVF36VmplGFP retrovirus (generously provided by Anthony Blau, University of Washington, Seattle, WA) was transfected into 293T cells using the Ca2+ phosphate precipitation method [33]. Virus containing supernatant was collected 48 hours after transfection and filtered through a 0.45-mm filter before use. The cell line CCE was spin-infected with high-titer viral supernatant in ES cell medium at 1,300 g for 90 minutes on a Beckman centrifuge (GH-3.8 rotor; Beckman Coulter; Fullerton, CA; http://www.beckman.com). Supernatant was removed the next day, and cells were passaged for 1 month, with the brightest 10% of GFP+ cells selected for subculture by fluorescence-activated cell sorting (FACS) each week. After 1 month, the brightest 0.1% of cells were FACS deposited into single wells of a 96-well dish preplated with mitotically inactivated mouse embryonic fibroblasts. Wells with single ES cell colonies were harvested and expanded into clonal cell lines. These clones were tested individually for activity of the FKBP fusion protein by generating EBs, disrupting and plating in the presence and absence of CID (AP20187, generously provided by ARIAD; Cambridge, MA; http://www.ariad.com/regulationkits). The clone CCE.j gave the best induction and was used for the blast colony-forming cell (BL-CFC) experiments.
BL-CFC Assay
EBs were collected at 4 days post differentiation, washed in PBS, and treated with 0.25% trypsin (GIBCO) for 3 minutes at 37°C. EBs were disrupted to single cells by repeated passage through a 23-G needle and plated at 5 x 104 cells in 1 ml of methylcellulose medium (M3120) with 10% FCS, 50 µg/ml ascorbic acid, 200 µg/ml iron-saturated transferrin, and 4.5 x 10-4 M MTG, in the presence and absence of TPO (25 ng/ml; Peprotech; Rocky Hill, NJ; http://www.peprotech.com), and in the presence or absence of the following factor conditions: VEGF, 5 ng/ml (Peprotech); SCF, 100 ng/ml (Peprotech); and VEGF/SCF. In some experiments, an anti-VEGF blocking antibody was added to the methylcellulose at an adequate concentration to neutralize all of the effects of VEGF supplementation (0.3 µg/ml; R&D Systems; Minneapolis, MN; http://www.rndsystems.com). Cultures were maintained in a humidified incubator at 37°C in an environment of 5% CO2 in air. After 5 days, developing BL-CFC were counted and picked for replating studies.
Generation of Hematopoietic Cells
BL-CFC were plucked and replated into secondary methylcellulose media containing interleukin-3 (IL-3), IL-6, erythropoietin (Epo), and SCF (M3434; StemCell). Cultures were maintained as described above and secondary hematopoietic colonies were scored at 710 days of growth.
Generation of Endothelial Cells and Their Characterization
Individual BL-CFC were picked and transferred to matrigel-coated microtiter wells (Collaborative Research; Bedford, MA) containing IMDM with 10% FCS, 10% horse serum (GIBCO), VEGF (5 ng/ml), insulin growth factor-1 (IGF-1, 10 ng/ml; Peprotech), Epo (2 U/ml; R&D), basic fibroblast growth factor (bFGF, 10 ng/ml; Peprotech), IL-11 (50 ng/ml; R&D), SCF (100 ng/ml), endothelial cell growth supplement (ECGS, 100 µg/ml; Collaborative Research), L-glutamine (2 mM), and 4.5 x 10-4 MTG [29]. After 34 days in culture, nonadherent cells were removed and adherent cells were cultured for an additional 12 weeks in IMDM with 10% FCS, 10% horse serum, VEGF (5 ng/ml), IGF-1 (10 ng/ml), bFGF (10 ng/ml), ECGS (100 µg/ml), L-glutamine (2 mM), and 4.5 x 10-4 MTG. When confluent, cells were harvested by trypsinization and analyzed for flk-1 and tie-2 expression.
Cell Staining
BL-CFCs were plucked onto prewashed glass cover slips that were coated with a thin layer of matrigel and cultured in 12-well dishes in medium containing both hematopoietic and endothelial cytokines, as described above. Four to 7 days following the initiation of the cultures, the nonadherent hematopoietic cells were removed and the adherent cells were cultured for an additional 12 weeks in medium containing only endothelial growth factors (see above). For fluorescence analysis, adherent cells were initially cultured in the presence of 10 µg/ml of Dil-Ac-LDL (Biomedical Technologies; Stoughton, MA; http://www.btiinc.com) at 37°C for 2 hours. Following this incubation, the cells were washed three times and fixed for 10 minutes in PBS containing 3% paraformaldehyde and 3% sucrose. The fixed cells were washed two to three times and incubated with fluorescein isothiocyanate-mouse anti-CD31 (Pharmingen; San Diego, CA; http://www.bdbiosciences.com/pharmingen) for 1 hour. Following this staining, cells were washed again (five times) and the coverslip with the cells was mounted onto a slide for analysis [29]. The images were acquired with a digital confocal microscope using the Zeiss LSM-510 software program (Oberkochen, Germany).
Mouse Dissection
Mature 129SvEv females were caged with breeding males. The day of vaginal plug observation was considered as day 0.5 postcoitum. Pregnant dams were sacrificed by CO2 asphyxiation and embryos isolated at E8.25 for yolk sac (YS) and E13.5 for fetal liver (FL) dissections. Adult BM cells were obtained by flushing femurs from adult mice.
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Analysis
Gene expression patterns in EBs, YS, FL, and BM cells, as well as BL-CFC and their derived cells, were determined using the global amplification strategy of Brady et al. [34]. Total RNA was isolated using RNA STAT-60 reagent (Tel-Test "B," Inc.; Friendswood, TX) as recommended by the manufacturer. First strand cDNA was produced using Superscript II reverse transcriptase (GIBCO). One microgram of total RNA was hybridized with 140 ng random hexamers in first strand reverse transcriptase buffer (50 mM Tris, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 500 µm deoxyribose nucleotide triphosphates) followed by addition of 200 U Superscript II reverse transcriptase and incubation at 42°C for 50 minutes. Five percent of first strand reaction was used for each ensuing PCR reaction. Primer sequences were as follows: A) ß-actin forward, GTGGGGCGCCCCAGGCACCA; ß-actin reverse, CTCCTTAATGTCACGCACGATTTC; B) c-mpl forward, CCTACTGCTGCTAAAGTGGCAAT; c-mpl reverse, CAATAGCTTAGTGGTAGGTAGGA; C) TPO forward, TCTGTCCAGCCCCGTAGGTC; TPO reverse, GTTCCATCCACAGGTCCGTG; D) flk-1 forward, CACCTGGCACTCTCCACCTTC; flk-1 reverse, GATTT CATCCCACTACCGAAAG; E) tie-2 forward, ATGGAC TCTTTAGCCGGCTTA; and tie-2 reverse, CCTTATAGC CTGTCCTCGAA.
| RESULTS |
|---|
|
|
|---|
|
ES cells had been differentiating into EBs for 4 days when we detected the maximal number of BL-CFC. The EBs were disrupted and plated in medium for detection of BL-CFC [28] with or without supplemental TPO, VEGF, and SCF (Fig. 2
). When added alone, TPO supported BL-CFC formation (Fig. 3A
). Moreover, TPO stimulated an approximately twofold increase in the number of BL-CFC in cultures supplemented by VEGF and/or SCF (Fig. 3A
). In order to evaluate if BL-CFC grown under different conditions express the receptor for TPO, mRNA was obtained from single colonies, which were plucked in duplicate for each culture condition (TPO alone, VEGF/SCF/TPO, and VEGF/SCF). We detected c-Mpl expression in all samples examined (Fig. 1
, right side), except for one TPO-stimulated colony probably due to insufficient mRNA (lane 1). The finding that BL-CFC grown in the absence of TPO (lanes 5 and 6) express c-Mpl suggests that the hemangioblast has an intrinsic capacity to respond to TPO.
|
|
We also questioned whether conditional regulation of c-Mpl receptor signaling would enhance hemangioblast formation. For this purpose, ES cells were infected with a retrovirus carrying the chemical dimerizer-dependent domain of FKBP (F36V) fused to the cytoplasmic domain of c-Mpl [31], allowing for signals to be delivered in a regulated manner. Infected ES cells were cultured for several weeks and FACS sorted to isolate cells with the highest levels of green fluorescent protein expression. Subclones were derived and tested individually for activity of the FKBP fusion protein. Clone CCE.j gave the best induction and was used for the BL-CFC experiments. CCE.j cells grown in the presence of CID yielded an increased number of BL-CFC when compared with cells grown in the absence of CID (Fig. 3C
). The number of BL-CFC generated by untreated CCE.j clonal cell line was lower than that of the parental ES cell line (Fig. 3A
). Since we have observed a similar outcome with other clones (data not shown), we believe that overexpression of the construct may be somewhat deleterious to blast colony formation. Nevertheless, the increase in the number of BL-CFC in the presence of CID demonstrates that c-Mpl signaling can augment BL-CFC formation.
In order to confirm that the TPO-responsive precursors correspond to the hemangioblast, we proceeded with further hematopoietic and endothelial characterization (Fig. 4
). We compared the hematopoietic replating potential of BL-CFC colonies grown under different conditions, including VEGF/SCF, VEGF/SCF/TPO, TPO alone, and base media with no growth factor added. Single colonies were picked and dispersed into methylcellulose with a cocktail of hematopoietic cytokines. We observed no hematopoietic replating potential for the infrequent BL-CFC that appeared in unsupplemented base media. However, BL-CFC grown under the three combinations of growth factors yielded similar frequencies of secondary hematopoietic colonies after replating (range, 58.8%65.4%; Table 1
). The average number of secondary CFCs per replated BL-CFC was low in BL-CFC stimulated by TPO alone, with no obvious bias in the types of colonies produced (Fig. 4A
). The overall number of secondary hematopoietic colonies was enhanced by the addition of VEGF and SCF (Table 1
), in agreement with a previous report that demonstrated that SCF potentiates the hematopoietic replating of VEGF-stimulated BL-CFC [28]. These data indicate that TPO-stimulated BL-CFC have hematopoietic potential that is further augmented by VEGF and SCF.
|
|
By RT-PCR, we analyzed the expression of the VEGF receptor, flk-1, as well as the endothelial marker, tie-2 [40] in adherent cells derived from TPO-stimulated BL-CFC. All clones of adherent cells expressed detectable levels of either or both flk-1 and tie-2 (Fig. 4C
). Our replating efficiency of 60% under either hematopoietic or endothelial conditions argues that a minimum of 20% of TPO-stimulated colonies have bipotentiality. However, given that the maximum replating efficiency reported for this assay is 80%, as described by Choi et al. [29], we believe that the majority of TPO-stimulated colonies are bipotential. Thus, we conclude that the TPO-stimulated precursors from EBs are hemangioblasts.
| DISCUSSION |
|---|
|
|
|---|
The spatial association between embryonic hematopoietic precursors and angioblasts in the YS blood islands, as well as the common expression of Flk-1 [22, 25], PECAM [41], and CD34 [24] in hematopoietic and endothelial cells, prompted the hypothesis of a common precursor, the hemangioblast. Using a model system based on the in vitro differentiation of ES cells into EBs, Keller and colleagues identified the BL-CFC, a single cell that forms in response to VEGF, and when replated, yields endothelial and hematopoietic progeny [28, 29]. This is the most striking evidence to date for the existence of the hemangioblast. Corroborating the idea that the VEGF/Flk-1 interaction is fundamental for hemangioblast development, Nishikawa and colleagues demonstrated that Flk-1+ cells purified from differentiated ES cells show both hematopoietic and endothelial potential [42].
While VEGF, acting through its receptor FLK-1, stimulates hemangioblast formation, this signaling pathway is not unique in specifying hemangioblast development. Mice deficient in Flk-1 have dramatic defects in the development of hematopoietic and endothelial lineages, but Flk-1-/- embryos retain hematopoietic activity [43], and VEGF-deficient embryos display both hematopoietic and endothelial cells [44, 45]. Flk-1-/- ES cells generate BL-CFC, though at greatly reduced numbers [46], and there is no difference in hematopoietic and endothelial marker expression of Flk-1+/+, Flk-1+/-, and Flk-1-/- EB cells [46]. These data argue that VEGF is not the sole regulator of hemangioblast development and that other factors must be involved. Previous evidence that TPO-Mpl signaling plays a role in blast colony formation has been suggested by data that Mpl may act as a substitute for the tyrosine kinase receptor, Flk-1 [47]. Enforced expression of c-Mpl in Mpl-deficient ES cells resulted in a TPO-dependent response for BL-CFC, which are normally strictly dependent on VEGF. During the preparation of this manuscript, the same authors demonstrated a synergistic effect of TPO (pegylated recombinant human megakaryocyte growth and development factor) on the VEGF-dependent blast cell colony in wild-type c-mpl+/+ ES cells [48], suggesting that c-Mpl is naturally expressed in the BL-CFC. While careful characterization of the BL-CFC identified in their system was not performed, their data corroborate the results we describe here.
In our studies, BL-CFC stimulated by VEGF/SCF or TPO (alone or in combination) presented a comparable frequency of BL-CFC that yielded secondary hematopoietic colonies. However, when TPO was incorporated into the culture medium, the number of secondary CFCs was reduced. Such a result may be due to an enhancement of self-renewal at the expense of differentiation, a conclusion that is consistent with data from long-term cultures that have revealed TPO to be a self-renewal factor involved in the amplification of long-term culture-initiating cells [9, 49]. Furthermore, Yagi et al. have demonstrated by transplantation studies in lethally irradiated mice that 2-month-old long-term BM cultures stimulated by TPO resulted in superior lymphoid/ myeloid reconstitution when compared with long-term cultures maintained without TPO [9]. These data provide evidence that TPO is an important mediator of self-replication in vitro and in vivo. In support of these findings, it has been recently demonstrated by introducing chimeric cytokine receptors into murine BM cells that c-Mpl signaling can promote self-renewal of multipotent hematopoietic progenitor cells, whereas signals provided by G-CSF and Flt-3 do not [50]. Our results are consistent with a role for TPO in maintaining the self-renewal potential of the hemangioblast at the expense of differentiation to CFCs that can be scored by methylcellulose assay.
Although several studies have demonstrated the growth-promoting effects of TPO on early hematopoietic progenitors [5, 6, 9, 10], as well as in the growth and activation [19, 20] of endothelial cells, we have characterized a novel role for TPO signaling at the level of the hemangioblast, the bipotential precursor of these two lineages. In agreement with our results in the blast assay, we detected c-Mpl expression during EB differentiation as early as day 3, the first day when BL-CFC form. Moreover, we have detected expression of the TPO receptor in BL-CFC stimulated by VEGF and SCF, as well as in precirculation YS cells (day 8.25). The BL-CFC has not been identified in the embryo, but we anticipate that such a cell should be detectable from the precirculation YS. Our data establish a role for TPO and its receptor, c-Mpl, at early stages of hematopoiesis and implicate TPO as a potential physiological regulator of the common precursor of hematopoietic and endothelial cells.
Since hematopoietic and endothelial development are not extinguished by targeted inactivation of either c-Mpl or TPO genes [12], there must be redundancy of cytokine receptor pathways acting on the hemangioblast. In this regard, in addition to VEGF/Flk-1 [43], some reports have suggested that bone morphogenetic protein-4 [51, 52] and transforming growth factor ß-1 [53] also play a role at early stages of development. Thus, the hemangioblast and the HSC are regulated by overlapping sets of signaling molecules. Our results establish a model in vitro system for further studies to define the unique contributions of TPO on the earliest stages of hematopoietic commitment.
| ACKNOWLEDGMENT |
|---|
|
|
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. Petit-Cocault, C. Volle-Challier, M. Fleury, B. Peault, and M. Souyri Dual role of Mpl receptor during the establishment of definitive hematopoiesis Development, August 15, 2007; 134(16): 3031 - 3040. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. R. Perlingeiro Endoglin is required for hemangioblast and early hematopoietic development Development, August 15, 2007; 134(16): 3041 - 3048. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yao, B. Liu, X. Wang, Y. Lan, N. Hou, X. Yang, and N. Mao Identification of High Proliferative Potential Precursors with Hemangioblastic Activity in the Mouse Aorta-Gonad- Mesonephros Region Stem Cells, June 1, 2007; 25(6): 1423 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-M. Zou, M.-H. Luo, A. Reed, M. R. Kelley, and M. C. Yoder Ape1 regulates hematopoietic differentiation of embryonic stem cells through its redox functional domain Blood, March 1, 2007; 109(5): 1917 - 1922. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tober, A. Koniski, K. E. McGrath, R. Vemishetti, R. Emerson, K. K. L. de Mesy-Bentley, R. Waugh, and J. Palis The megakaryocyte lineage originates from hemangioblast precursors and is an integral component both of primitive and of definitive hematopoiesis Blood, February 15, 2007; 109(4): 1433 - 1441. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Priddle, D. R. E. Jones, P. W. Burridge, and R. Patient Hematopoiesis from Human Embryonic Stem Cells: Overcoming the Immune Barrier in Stem Cell Therapies Stem Cells, April 1, 2006; 24(4): 815 - 824. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, F. Yates, O. Naveiras, P. Ernst, and G. Q. Daley Embryonic stem cell-derived hematopoietic stem cells PNAS, December 27, 2005; 102(52): 19081 - 19086. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Amano, N. R. Hackett, S. Rafii, and R. G. Crystal Thrombopoietin Gene Transfer-Mediated Enhancement of Angiogenic Responses to Acute Ischemia Circ. Res., August 19, 2005; 97(4): 337 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Chute, G. G. Muramoto, J. Fung, and C. Oxford Soluble factors elaborated by human brain endothelial cells induce the concomitant expansion of purified human BM CD34+CD38- cells and SCID-repopulating cells Blood, January 15, 2005; 105(2): 576 - 583. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
