Stem Cells 2003;21:459-471
www.StemCells.com
© 2003 AlphaMed Press
Transcriptional Profiling of Neuronal Differentiation by Human Embryonal Carcinoma Stem Cells In Vitro
Stefan Alexander Przyborskia,
Stanley Smithb,
Andrew Woodb
a School of Biological and Biomedical Science, University of Durham, Science Laboratories, Durham, United Kingdom;
b Department of Cellular Neuroscience, Wyeth-Neuroscience, Monmouth Junction, New Jersey, USA
Key Words. Embryonal carcinoma • Stem cell • Human • Neurogenesis • Gene transcription • Microarray
Stefan Alexander Przyborski, Ph.D., School of Biological and Biomedical Science, University of Durham, South Road, Durham, DH1 3LE, United Kingdom. Telephone: 44-0-191-374-3341; Fax: 44-0-191-374-2417; e-mail: stefan.przyborski{at}durham.ac.uk
 |
ABSTRACT
|
|---|
Pluripotent stem cell lines can be induced to differentiate into a range of somatic cell types in response to various stimuli. Such cell-based systems provide powerful tools for the investigation of molecules that modulate cellular development. For instance, the formation of the nervous system is a highly regulated process, controlled by molecular pathways that determine the expression of specific proteins involved in cell differentiation. To begin to decipher this mechanism in humans, we used oligonucleotide microarrays to profile the complex patterns of gene expression during the differentiation of neurons from pluripotent human stem cells. Samples of mRNA were isolated from cultured NTERA2 human embryonal carcinoma stem cells and their retinoic-acid-induced derivatives and were prepared for hybridization on custom microarrays designed to detect the expression of genes primarily associated with the neural lineage. In response to retinoic acid, human NTERA2 cells coordinately regulate the expression of large numbers of neural transcripts simultaneously. Transcriptional profiles of many individual genes aligned closely with expression patterns previously recorded by developing neural cells in vitro and in vivo, demonstrating that cultured human pluripotent stem cells appear to form neurons in a conserved manner. These experiments have produced many new expression data concerning neuronal differentiation from human stem cells in vitro. Of particular interest was the regulated expression of Pax6 and Nkx6.1 mRNA and the absence of Pax7 transcription, indicating that neurons derived from NTERA2 pluripotent stem cells are characteristic of neuroectodermal cells of the ventral phenotype.
 |
INTRODUCTION
|
|---|
The development of the central nervous system (CNS) and the formation of its multitude of distinct neural cell subtypes are precisely controlled processes involving the formation, proliferation, and subsequent differentiation of committed multipotent stem cells. This undoubtedly involves the selective expression and repression of regulatory and structural genes, in particular, cells at specific stages of differentiation. Recent advances in developmental genetics and genomics have now identified the locations, sequences, and functions of many genes involved in these processes. However, most studies have so far focused upon the mechanisms of particular regulatory pathways in isolation, which may give a simplistic interpretation of the roles played by specific genes when the interactions of multiple pathways are considered. Little is known of how such genes and their products function and interact at the cellular level and how the proteins that they encode function during normal development and neurological disease.
Established stem cell lines capable of differentiating into neurons in culture provide a valuable tool in which the roles of different genes and their interactions during neural differentiation can be explored. Particularly pertinent to the early stages of neural differentiation are embryonal carcinoma (EC) and embryonic stem (ES) cell lines. EC cells derived from teratocarcinomas provide a caricature of ES cells derived directly from early embryos, and sometimes can provide a simpler model because of their more restricted developmental capacities that are a consequence of their tumor origin. Among human EC cell lines, NTERA2 has been widely used to investigate aspects of embryonic cell differentiation and neurogenesis, with particular regard to human embryogenesis. Recent studies have confirmed the close relationship between human EC cells, including NTERA2 stem cells, and human ES cells [1]. Such studies have further underlined the existence of differences between human and mouse EC/ES cells, indicating that data from the laboratory mouse cannot necessarily be extrapolated to human development, and that studies of both human and murine development are complementary.
NTERA2 EC cells differentiate into a variety of cell types when grown as xenograft tumors or when exposed in vitro to agents that include retinoic acid, hexamethylene bisacetamide, and the bone morphogenetic proteins [24]. The lineages induced by these agents are distinct, but neural differentiation is especially prominent following induction with retinoic acid [5, 6], though many other cells, probably representing mesenchymal cells, including smooth muscle and cartilage, that are perhaps of neural crest origin, also arise. Many features of NTERA2-derived neurons have been reported, including: A) they express all three neurofilament proteins [7] and N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor channels [8]; B) they exhibit tetrodotoxin-sensitive sodium ion channels and regenerative membrane potentials [9]; C) they regulate intracellular calcium in response to stimulation of cell surface muscarinic and glutamate receptors [10], and D) they establish functional synapses [11]. Recently, we have shown that the changes in gene expression during this neural differentiation of NTERA2 cells parallel changes seen during cell differentiation in the neural tube of the developing embryo [6]; nestin expression is induced soon after differentiation is initiated and is followed several days later by a peak in expression of neuroD1, encoding a basic helix-loop-helix leucine zipper transcription factor characteristic of postmitotic neuroblasts, followed by the appearance of gene expression characteristic of mature neurons (e.g., synaptophysin). Accordingly, the NTERA2 system offers a convenient and robust model for studying the commitment of human pluripotent stem cells to the neural lineage and their subsequent development into a terminally differentiated neural phenotype.
Many studies devoted to identifying biologically relevant, differentially expressed genes between stem cells and their differentiated derivatives have been limited to the quantitation and characterization of transcription changes for a small number of genes at a time. However, the definition of the expression profile of large numbers of genes simultaneously under a variety of different experimental conditions is key in deciphering the complex control of these processes. Transcriptional profiling using microarrays provides a novel approach to monitor the coordinate expression of large numbers of genes simultaneously in a single hybridization. For example, cDNA microarrays have been successfully used in the identification and cloning of genes with potential relevance to growth control and terminal differentiation in ovarian carcinomas [12], glioblastomas [13, 14], and human melanoma cells [15]. More recently, commercially available nylon filter arrays of cDNA probes have been used to monitor transcription changes during the differentiation of mammalian stem cells [16, 17]. However, it is apparent that such experiments are currently limited when using commercially available arrays that have a restricted general representation of the gene pool and often possess few genes that specifically are relevant to the particular study. Therefore, to specifically investigate gene regulation during human neural differentiation, we designed and constructed a customized oligonucleotide microarray representing many known genes pertinent to developmental neurobiology. Using this microarray, we now report the coordinate regulation of multiple neural transcripts simultaneously during the formation of terminally differentiated neurons from human pluripotent NTERA2 stem cells.
 |
MATERIALS AND METHODS
|
|---|
Cells
NTERA2.cl.D1 (NTERA2) EC stem cells were maintained at high cell densities in Dulbeccos modified Eagles medium (high-glucose formulation) (Life Technologies Ltd.; Paisley, Scotland; http://www.lifetech.com), supplemented with 10% fetal calf serum at 37°C under a humidified atmosphere of 10% CO2 in air, as previously described [18]. Differentiation of NTERA2 cells was induced by harvesting with trypsin:EDTA (Life Technologies) and seeding at a density of 106 cells per 75-cm2 flask in the same medium supplemented with 10 µM trans-retinoic acid (Sigma-Aldrich Company Ltd.; Poole, UK; http://www.sigmaaldrich.com) [2]. Differentiating cultures were re-fed with fresh medium containing retinoic acid at 7-day intervals until harvested. Neurons were purified from NTERA2 cultures obtained after 28 days in the presence of retinoic acid, as described by Pleasure et al. [19].
Surface Antigen Expression
Surface antigen expression was analyzed on live cells using indirect immunofluorescence and flow cytofluorimetry, as previously described [20].
Northern Analysis
Poly[A+] RNA was isolated from cultured cells and prepared for Northern blotting as previously described [6, 21]. The blot was hybridized with a 2127 bp BamHI-XbaI fragment of Pou5f1, generously provided by F. Gandolfi, Institute of Anatomy, Milan, Italy [22], and the hybridization signal was detected by autoradiography.
Reverse Transcription-Polymerase Chain Reaction
Poly[A+] RNA was isolated from samples of undifferentiated and retinoic-acid-induced derivatives of NTERA2 for subsequent reverse transcription-polymerase chain reaction (RT-PCR) analysis as previously described [23]. Standard PCR reactions were performed in a 25-µl reaction volume using 20 pmol of specific primers corresponding to the human forms of either nestin, neuroD1, synaptophysin, or Pax6. PCR primers were designed using the Primer Select package (DNAstar Inc.; Madison, WI; http://www.dnastar.com). The GenBank accession number, product size, recognition site, forward and reverse primer sequence, and annealing temperature for each primer set were as follows: nestin: X65964
[GenBank]
, product 506 bp, bases 3891-4396, CACTCCCCTGGGCTTCTACC, AGGGGACGCTGAC ACTTACA, 59°C; neuroD1: U50822
[GenBank]
, product 453 bp, bases 429-881, CCAAAAAGAAGAAGATGACTAAGG, AGCTGTCCATGGTACCGTAA, 58°C; synaptophysin: X06389
[GenBank]
, product 621 bp, bases 498-1118, CCGCCAGAC AGGGAACACAT, AGGGGGCCCACTCAAGACTG, 61°C; Pax6: M93650
[GenBank]
, product 275 bp, bases 1368-1642, AACAGACACAGCCCTCACAAACA, CGGGAACTTGA ACTGGAACTGAC, 62°C; and Nkx6.1: NM_006168
[GenBank]
, product 411 bp, bases 655-1065, GCACGCCTGGCCTG TACCCCTCAT, GCCGCCGCCGCTGCTGGACTT, 60°C. PCR was also conducted using primers specific for human ß-actin (ATCTGGCACCACACCTTCTACAATGAGCT GCG, CGTCATACTCCTGCTTGCTGATCCA CATCTGC) to control for equivalent amounts of DNA per reaction. The specificity of all primers was checked by sequencing of the PCR products (ABI Prism Big Dye Terminator cycle sequencing; Perkin Elmer; Warrington, UK; http://www.appliedbiosystems.com) and Southern blot analysis using standard procedures [24] (data not shown).
Microarray Analysis
Sample Preparation
Total RNA was isolated from samples of undifferentiated NTERA2 and 2102Ep cultures, retinoic-acid-induced derivatives of NTERA2, and from purified NTERA2 neurons using Tri-reagent (Sigma-Aldrich) and Poly[A+] RNA subsequently prepared with Oligotex (Qiagen Ltd.; Crawley, UK; http://www.qiagen.com). One microgram of poly[A+] RNA was used for first-strand cDNA synthesis at 37°C for 60 minutes and was subsequently converted into double-stranded cDNA (dsDNA) using SuperScript Choice System (Life Technologies) with an oligo(dT) primer containing a T7 RNA polymerase promoter (Genset Corp.; La Jolla, CA; http://www.gensetoligos.com). After second-strand synthesis, the reaction was extracted with phenol:chloroform:isoamyl alcohol with phase lock gel (5-Prime-3-Prime, Inc.; Boulder, CO; http://www.5prime.com) and dsDNA recovered by ethanol precipitation using glycogen as a carrier. In vitro synthesis of biotin-labeled cRNA was performed using a T7 Megascript kit (Ambion; Austin, TX; http://www.ambion.com) with a 1.5-µl dsDNA template in the presence of a mixture of unlabeled ATP, GTP, CTP, and UTP and biotin-labeled CTP and UTP (bio-11-CTP and bio-16-UTP, Enzo Diagnostics, Inc.; Farmingdale, NY; http://www.enzo.com). Biotinylated cRNA was subsequently purified using RNeasy affinity columns (Qiagen), ethanol precipitated, and quantified. Labeled cRNA target was fragmented randomly to RNA species ranging from 35200 bases. Fragmentation was performed at 94°C for 35 minutes in the presence of 40 mM tris-acetate (pH 8.1), 100 mM potassium acetate, and 30 mM magnesium acetate.
Hybridization, Washing, and Scanning
The hybridization solution consisted of 20 µg fragmented cRNA (final concentration, 0.05 µg/µl) and 0.1 mg/ml herring sperm DNA in 1X 2-(N-morpholino)-ethanesulfonic acid (MES) buffer (containing 100 mM MES, 1 M Na+, 20 mM EDTA, and 0.01% Tween 20 [Sigma-Aldrich]). Prior to injection of the hybridization mixture into the probe array cartridge, the solution was heated to 99°C for 5 minutes. Hybridization was carried out at 45°C for 16 hours with continuous mixing on a rotisserie at 60 rpm. Afterward, the hybridization mixture was removed, and the array was rinsed with 1x MES solution. Subsequent washing and staining of the arrays were carried out using the GeneChip Fluidics station protocol EukGE_WS1 (Affymetrix; Santa Clara, CA; http://www.affymetrix.com). In brief, the first wash consisted of 10 cycles of two mixes per cycle with nonstringent wash buffer (6x SSPE, 0.01% Tween 20, 0.05% antifoam) at 25°C. The second wash consisted of four cycles of 15 mixes per cycle with stringent wash buffer (100 mM MES, 0.1M NaCl, 0.01% Tween 20) at 50°C. The probe arrays were stained for 30 minutes in streptavidin-phycoerythrin solution (1x MES, 0.005% antifoam, 10 µg/ml R-streptavidin-phycoerythrin [Molecular Probes; Eugene, OR; http://www.probes.com], 2 µg/µl acetylated bovine serum antigen) at 25°C. Post-stain washing of 10 cycles of four mixes per cycle was performed with nonstringent wash buffer at 25°C. The hybridized array was immediately scanned twice at 3µm resolution using the GeneChip System confocal scanner (Hewlett-Packard; Palo Alto, CA; http://www.hp.com).
Custom Microarray
Microarray analysis in this study was performed on a custom array synthesized using light-directed combinatorial chemistry, as previously described [25, 26]. Our custom array contains probe sets of oligonucleotides 25 bases in length, representing 573 sequences that are complementary and correspond to known human genes registered in GenBank (http://www.ncbi.nlm.nih.gov). Briefly, each gene is represented by approximately 20 oligonucleotides that are identical to the sequence in the gene. In addition, there are an equal number of oligonucleotides that contain a homomeric (base transversion) mismatch at the central base position of the oligomer, which act as specificity controls to allow the direct subtraction of both background and cross-hybridization signals. Probes were selected with a bias toward the 3' regions of the gene. Probe pairs representing human genes such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ß-actin, transferrin receptor, and transcription factor interferon-stimulated gene factor 3 served as internal controls for monitoring RNA integrity. Probe arrays also contained oligonucleotides representing sequences of bacterial genes BioB, BioC, and BioD and one phage gene, Cre, as quantitative standards. Copy numbers for each mRNA species were calculated by correlating the known concentrations of spiked standards of bacterial/phage mRNAs with their hybridization intensities as previously described [27].
Analysis
GeneChip 3.0 software (Affymetrix) was used for scanning and for first pass analysis and generation of raw data cell intensity (.cel) files. Data were subsequently submitted to a relational database for quality control assessment to include RNA quality, GeneChip sensitivity, and process quality determinations. All experiments that satisfied these criteria were then visualized and analyzed using GeneSpring 3.0 (Silicon Genetics; Redwood City, CA; http://www.silicongenetics.com). Cluster analysis was performed using a predetermined algorithm (GeneSpring 3.0) to group genes that showed similar profiles of expression. Relative intensity was used as an arbitrary measure of mRNA copy number. Some data were analyzed graphically using scatter plots on Spotfire Pro 4.0 (Spotfire Inc.; Cambridge, MA; http://www.spotfire.com) with the distance from the diagonal line as a measure of the difference in expression level for a particular gene in each sample. GenBank accession numbers are quoted throughout this report for clarification of gene identity.
 |
RESULTS
|
|---|
Cultured NTERA2 cells displayed a typical human EC morphology (Fig. 1A
) and rapidly differentiated in response to 10-5 M retinoic acid, producing heterogeneous cultures containing a variety of cell types (Fig. 1B
). Neurons were especially prominent in such cultures 24 weeks after initial exposure to retinoic acid. Such neurons represent ~5% of the differentiated cells in these cultures, but they can be purified as described by Pleasure et al. [19] and subsequently maintained in culture (Fig. 1C
). The expression of cell surface markers was examined on all samples of cells before their use in gene expression studies as a check of their EC and differentiated phenotype. NTERA2 EC cells expressed typical human EC cell surface marker antigens (SSEA3, SSEA4, and TRA-1-60), as previously described [18, 28], while retinoic-acid-induced differentiation of NTERA2 was marked by a downregulation of SSEA3, SSEA4, and TRA-1-60 and the appearance of antigens such as SSEA1, A2B5, and ME311 [5, 20] (data not shown).

View larger version (84K):
[in this window]
[in a new window]
|
Figure 1. Phase contrast micrographs of pluripotent human stem cells and their differentiated derivatives. A) NTERA2 EC stem cells. After exposure to retinoic acid for 21 days, cultures of NTERA2 stem cells contained a variety of morphologically distinguishable differentiated cell types (B). In particular, aggregations of neuronal perikarya from which develop elaborate networks of neural processes can be seen resting on top of a background of non-neuronal cells (B). Populations of NTERA2 neuronal cells (C) are readily enriched as previously described [19]. Scale bars: 25 µm (A, C); 330 µm (B).
|
|
Transcriptional profiling of RNA isolated from human EC cultures and their differentiated derivatives was performed using microarrays. For this study, we produced a custom microarray designed to monitor gene expression during the differentiation of human stem cells into neural derivatives. Accordingly, the majority of probes we selected were specific for genes known to be involved in the process of neural differentiation in vertebrates and for molecules associated with the nervous system in general. While our gene list is not exhaustive, it does represent many of the molecular mechanisms associated with neural development.
Microarray technology has enormous potential and is capable of generating large amounts of data; however, it is also essential to consider the possibility of false-positive expression patterns that can lead to potentially misleading results. In this study, great care has been taken to reduce the risk of false positives by repeating experiments and setting a high threshold for significant reproducible changes in gene expression. Microarray analysis was repeated on different sets of samples and showed a high degree of robust reproducibility. The microarray data shown represent analyses from three complete time course experiments involving samples taken from stem cells, differentiating cells (at 7 and 14 days exposure to retinoic acid), and purified populations of neurons. We primarily report only those changes that are fivefold and greater, and we are, therefore, confident that we are observing real changes in gene expression. Moreover, traditional molecular techniques, such as RT-PCR and Northern analysis were used to confirm the transcriptional regulation for certain genes (see below). Cluster analysis was performed to examine groups of genes that showed similar profiles of expression in each experiment. Expression profiles were sorted into one of three cluster groups: cluster 1) genes that showed a profile that increased; cluster 2) genes whose profile decreased; and cluster 3) transcripts that displayed little change in expression during the experiment.
To monitor the regulation of gene expression during the formation of human NTERA2 neurons, samples of RNA were isolated from NTERA2 stem cells and their differentiated derivatives and subsequently prepared for gene expression analysis. It has been previously reported that the octamer-binding transcription factor-4 (Pou5f1) is expressed in human pluripotent stem cells but not in their differentiated derivatives [22, 29, 30]. Using Northern analysis, we detected Pou5f1 mRNA at greatest concentrations in NTERA2 stem cells, while Pou5f1 expression was rapidly downregulated in response to retinoic-acid-induced differentiation (Fig. 2A
). In order to ascertain whether cultures of differentiating cells prepared for this investigation were comparable with those used in earlier studies [6, 31], we tested RNA samples for the expression of neural genes using RT-PCR techniques (Fig. 2B
). The transcriptional profiles of nestin, neuroD1, and synaptophysin followed a similar trend to our previous findings [1, 6, 31] and correlated with the appearance of morphologically identifiable neuronal cell types.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. Validation of gene transcription during retinoic acid (RA)-induced differentiation of human NTERA2 EC cells and their purified neuronal derivatives. A) Northern analysis of the pluripotent stem cell marker, Pou5f1. Expression by GAPDH represents a loading control. B) Transcriptional analysis of neural genes using RT-PCR. The non-neuronal sample represents cells remaining after the neuron purification. Expression of ß-actin was used as a loading control. C) Transcriptional profiling of neural genes using microarrays. Gene expression is represented as relative intensity. Each data point represents mean level of transcript expression, ± one standard deviation (n = 3). See text for further details. Abbreviation: d RA = number of days exposure to retinoic acid (RA).
|
|
The expression patterns of the molecular markers examined by RT-PCR and Northern blot were subsequently compared with microarray analysis of RNA isolated from the same samples of cells (Fig. 2C
). Genes encoding the proteins Nestin, NeuroD1, and synaptophysin shared almost identical transcriptional profiles with RT-PCR data, while the transcript encoding POU5F1 followed a corresponding pattern of expression to that determined by Northern analysis. Moreover, constitutively expressed housekeeping genes, such as ß-actin and
-tubulin, did not show significant regulation as expected (Fig. 2
). Thus, transcriptional profiles produced by microarray analysis were appropriately confirmed for certain key transcripts using more traditional molecular approaches. Similarly, our microarray data also agreed with several results from other earlier work concerning the expression of non-neuronal genes and proteins regulated in human EC cells and their differentiated derivatives. For example, E-, P-, and N-cadherin proteins have been shown to be differentially expressed in various human EC cell lines, including NTERA and 2102Ep [32]. Microarray data for the genes encoding these cadherin proteins showed similar profiles of expression in RNA samples prepared from the same human EC cell types (data not shown). In addition, differential control of Hox gene expression, described in earlier reports [33, 34], was also reproduced by the current microarray experiments. For example, retinoic acid induced the stable expression of several HoxB genes in differentiated derivatives of NTERA2 cells (data not shown). Accordingly, consistent expression patterns of genes on the microarray and their corresponding expression in previous studies further support the overall transcriptional profile observed during the differentiation of human pluripotent stem cells.
Given the dramatic changes that stem cells experience during differentiation, it is highly likely that this process is accompanied by equally dramatic changes in gene transcription. Using cluster analysis, we identified three groups of genes that either showed marked increases in expression during 21 days of differentiation (cluster 1), displayed downregulation in the stem cell population (cluster 2), or had levels of expression that did not alter during the differentiation process (cluster 3) (Fig. 3A
). Distribution of the number of transcripts in clusters 13 was 21%, 68%, and 11%, respectively. While the majority of genes that showed upregulation (cluster 1) were associated with the neural lineage, this only represented a small percentage of the total number of genes present on the array. The vast majority of sequences did not show significant transcriptional regulation (cluster 2). This correlates with the fact that neurons represent only ~5% of the total differentiating cell population, therefore, the expression of neuron-specific sequences will be diluted by sequences expressed in non-neuronal cell types. This is a consequence of heterogeneity in the culture and limits the ability to examine the regulation of neural genes specifically.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 3. Cluster analysis of microarray gene expression data during retinoic-acid-induced differentiation of NTERA2 EC cells. The expression profile for each gene on the array was assigned to one of three groups using cluster analysis (clusters 13). The various symbols indicate the assignment of different genes to alternative clusters (see key). Gene expression is represented as relative intensity. A) Time course of transcriptional regulation over 21 days of differentiation. Data represent mean ± one standard deviation for three independent time course experiments. B) Scatter plot representation of mRNA expressed in NTERA2 EC stem cells compared with purified populations of NTERA2-derived neurons. For clarity, data from a single comparison are shown while other experiments closely followed the same trend (See Table 1 and text for further details).
|
|
Oligonucleotide microarrays were also used to directly compare the transcriptional activities of multiple numbers of genes simultaneously between homogeneous populations of NTERA2 stem cells and their purified neuronal derivatives (Fig. 3B
). Cluster analysis was again performed to group differences in gene expression into one of three clusters: those with higher expression levels in NTERA2 neurons (cluster 1), those with higher expression in NTERA2 EC stem cells (cluster 2), and those with roughly equal levels of expression (cluster 3). Distribution of the number of genes in clusters 13 was 64%, 5%, and 31%, respectively. Markers associated with neural cells were coordinately upregulated during the differentiation of human EC stem cells into mature neurons (cluster 1, Table 1
). Transcripts that showed fivefold or greater changes in expression included neuronal markers and mRNAs encoding homeobox proteins, with other genes, such as those involved with the development of smooth muscle (actsa) [35] and cartilaginous tissues (bmp1) [36, 37], also showing upregulation. Large numbers of neural transcripts in cluster 1 were also upregulated but at lower levels (i.e., 3.0- to 5.0-fold change) notably those encoding the proteins reelin (U79716
[GenBank]
), tau (J03778
[GenBank]
), N-type calcium channel (M94173
[GenBank]
), glutamic acid decarboxylase (M70434
[GenBank]
), Sox10 (AJ001183
[GenBank]
), pleiotrophin (X52946
[GenBank]
), syntaxin (L37792
[GenBank]
), GABA receptor (S62907
[GenBank]
), ciliary neurotrophic factor receptor (M73238
[GenBank]
), neuroD1 (U43843
[GenBank]
), pentaxin (X63613
[GenBank]
), and NCAM (U63041
[GenBank]
) (data not shown). In contrast, NTERA2 EC cells expressed transcripts that are mostly associated with the stem cell phenotype or early stages of development, and showed significant reduction in expression in neuronal samples (cluster 2, Table 1
). The profile of cluster 3 indicates that these transcripts showed minimal changes in transcription during retinoic-acid-induced NTERA2 differentiation, although individual mRNA concentrations were maintained at different levels and included abundant genes such as ß-actin and
-tubulin (cluster 3, Table 1
).
View this table:
[in this window]
[in a new window]
|
Table 1. Comparison of absolute gene expression levels in NTERA2 stem cells and purified populations of NTERA2-derived neurons
|
|
Pax proteins have been implicated as regulators of cell fate specification and development [38]. To identify whether particular members of the Pax family of genes were differentially expressed toward the neural lineage during retinoic-acid-induced human stem cell differentiation, the transcriptional profiles of several Pax family members were grouped and compared (Fig. 4A
). Only one member of the Pax family transcripts represented on the microarray showed differential regulation. The transcriptional profile of Pax6 during retinoic-acid-induced differentiation of human pluripotent stem cells correlated with the appearance of neurons and regulation of other neural transcripts. The induction of Pax6 expression during differentiation may indicate the formation of neurons of ventral character. While no other markers of ventral neurons were represented on the array, RT-PCR analysis showed that Pax6 transcription compared favorably with the expression profile of Nkx6.1, an additional marker of ventral neurons, during the formation of neurons from NTERA2 EC cells (Fig. 4B
). Moreover, bone morphogenetic protein 4, a regulator of dorsal cell fate in the developing neural tube, was not expressed in neurons derived from human EC cells (data not shown).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 4. Transcriptional regulation of markers associated with ventral neurons during retinoic acid (RA)-induced differentiation of NTERA2 stem cells. A) Differential control of mRNA transcription by members of the PAX homeodomain transcription factor. Gene expression is represented as relative intensity. Data represent mean ± one standard deviation for three independent time course experiments. See text for further details. B) Regulation of Pax6 and Nkx6.1 expression was determined by RT-PCR. Expression of ß-actin was used as a loading control.
|
|
 |
DISCUSSION
|
|---|
The differentiation of stem cells and the formation of specific cell lineages require highly regulated and tightly controlled transcription of multiple numbers of genes encoding structural and regulatory proteins. We used oligonucleotide microarrays to study the complex patterns of gene expression during the development of terminally differentiated neurons from human NTERA2 pluripotent stem cells. Exposure of NTERA2 stem cells to retinoic acid induced the selective expression and repression of gene transcription that compared favorably with the differentiation of stem cells toward the neuronal lineage. For the first time, our results show the coordinate simultaneous regulation of neural gene transcription during the commitment of human stem cells toward the neuronal lineage. Several of the transcriptional profiles for individual genes displayed a strong correlation with patterns of gene expression found in other models of neural development both in vitro and in vivo.
Human pluripotent stem cells express numerous markers indicative of their stem cell status that are rapidly downregulated during their commitment to a differentiated cell type. Human pluripotent EC cells express the globoseries cell surface antigen markers SSEA3, SSEA4, and TRA-1-60 that are subsequently lost during induction of cellular differentiation [5, 18, 20, 28]. Pluripotent human ES cells also express these antigens [1, 39, 40] and Pou5f1 mRNA that encodes a POU domain transcription factor previously identified as a marker of pluripotent stem cells [21, 22, 29, 30]. In agreement, we describe the expression of Pou5f1 mRNA in NTERA2 EC stem cells and show its rapid downregulation during their differentiation. Concurrent with these changes in expression of markers for human pluripotent stem cells, we also report the consistent expression and differentiation-induced downregulation of several other transcripts, including, cripto, epha1, fzd2, gja1, tdgf1, and traf. Cripto and tdgf1 were both originally isolated from NTERA2 EC stem cells and show complete shutoff after inducing the cells to differentiate by treatment with retinoic acid [41, 42]. Similarly, gap junction protein connexin43, encoded by gene gja1, also shows downregulation during retinoic acid treatment of NTERA2 cells [43]. Several genes represented on the array are expressed in human carcinomas, including epha1 [44], Fzd2 [23], the Fzd2-related gene, FzE3 [45], gja1 [46], and traf4 [47], suggesting that they may be involved in the neoplastic process of tumors, including teratocarcinomas.
The genetic makeup of stem cells changes markedly as they commit toward differentiation. Our results show that markers of the pluripotent stem cell phenotype are rapidly downregulated after exposure to retinoic acid, and molecules associated with pathways of cellular differentiation are subsequently expressed. With particular regard to neural development, these data support our earlier findings and show the coordinate regulation of neural transcripts in association with the appearance of morphologically identifiable neurons [6]. For example, nestin, a marker of neuroprogenitor cells, is transiently expressed prior to the appearance of mature neurons. Several of the arrayed genes associated with the neural lineage were upregulated during and subsequent to the expression of nestin and showed similar expression profiles to those described in previous work on human EC cells [68, 17, 31, 43]. However, our current work also reports the regulation of many additional neural transcripts that have not been previously studied during the commitment of human pluripotent stem cells to the neural lineage. Genes encoding the growth-associated proteins SCG10 and GAP43 are two examples of developmentally regulated molecules understood to play a role in vertebrate neurogenesis [4850], that showed regulated transcription during the formation of human neurons. In addition, certain structural elements, such as microtubule-associated proteins, are indicative of maturing neurons [51, 52], and in this study mRNA-encoding microtubule protein was also detected in terminally differentiated human neural cells. Maturation of NTERA2 neurons was further indicated by the expression of synaptosomal-associated protein (snap), synaptophysin (limo6), and synaptotagmin 1 (syt1), which agreed with previous evidence showing that NTERA2 neurons could form functional synapses [11].
Key molecules that play an important role in determining the specification of neural cell fate have been identified, and several homeodomain transcription factor proteins are thought to be involved in the control of neuroprogenitor cell identity and the specification of neuronal cell fate [53, 54]. In this study, we have shown that differentiating NTERA2 stem cells expressed Pax6 mRNA during the formation of mature neurons. Such expression is consistent with the involvement of Pax6 in neurogenesis, as recently described [55]. Furthermore, we report for the first time that the transcription of Pax6 and Nkx6.1 and the almost complete absence of dorsal markers such as Pax7 suggest that neurons generated from human pluripotent EC stem cells are ventral in character. This is in agreement with earlier reports showing the expression of homeoproteins in neuronal ventral and dorsal subtypes derived from retinoic-acid-induced mouse ES cells [56].
The transcriptional profile of multiple numbers of neural genes correlates favorably with the formation of neurons by pluripotent human stem cells. However, many of the popular markers used to indicate neural development tend to be generally expressed by a range of neural tissue types, and therefore, their expression does not necessarily define a particular neuronal subtype. More accurate determination of the identity of neurons derived from cultured stem cells requires analysis of more discrete markers such as specific receptor subtypes, ion channels, transcription factors, cell adhesion molecules, enzymes, etc. Our microarray data indicate the expression profile of many examples of such molecules (e.g., pcp4, cntn1, chat, ntrk4, ctnnd, nhlh2, calb2, clcn4, scn2a1, gria2, cacnb3). However, for most of these examples, it currently remains difficult to pinpoint exactly how their expression relates to determining the subtype of neuron produced by NTERA2 stem cells. Comparing such information with existing data in the literature is only partially useful since not all experiments will be applicable to the situation in comparison. An approach that may enable improved identification of neuronal subtypes derived from cultured stem cells is to compare the transcriptional profile of such neurons (as we have described here) with the expression of mRNAs isolated either from specific regions of the brain, primary cultures of neurons, or neural cell lines, where the identity of the neural cells is more exact. It is likely that only subtle differences exist between different neuronal subtypes, and the coordinate analysis of multiple numbers of genes simultaneously will further contribute to their identification and the understanding of their development.
 |
ACKNOWLEDGMENT
|
|---|
The authors would like to thank Professor Peter Andrews, University of Sheffield, UK, for his valued assistance and advice in reviewing this manuscript. This work was supported in part by awards to S.A.P. by The J.G. Graves Medical Research Fellowship, University of Sheffield, UK; The Peel Medical Research Trust, London, UK (Regd. Charity: 214683); and The Royal Society, London, UK (Regd. Charity: 207043).
 |
REFERENCES
|
|---|
- Andrews PW, Przyborski SA, Thomson JA. embryonal carcinoma cells as embryonic stem cells. In: Marshak DR, Gardner RL, Gottlieb D, eds. Stem Cell Biology. New York: Cold Spring Harbor Press, Monograph 40, 2001:231266.
- Andrews PW, Gonczol E, Plotkin SA. Differentiation of TERA-2 human embryonal carcinoma cells into neurons and HCMV permissive cells: induction by agents other than retinoic acid. Differentiation 1986;31:119126.[CrossRef][Medline]
- Andrews PW, Nudelman E, Hakomori SI et al. Different patterns of glycolipid antigens are expressed following differentiation of TERA-2 human embryonal carcinoma cells induced by retinoic acid, hexamethylene bisacetamide (HMBA) or bromodeoxyuridine (BUdR). Differentiation 1990;43:131138.[Medline]
- Andrews PW, Damjanov I, Berends J et al. Inhibition of proliferation and induction of differentiation of pluripotent human embryonal carcinoma cells by osteogenic protein-1 (or bone morphogenetic protein-7). Lab Invest 1994;71:243251.[Medline]
- Andrews PW. Retinoic acid induces neuronal differentiation of a cloned human embryonal carcinoma cell line in vitro. Dev Biol 1984;103:285293.[CrossRef][Medline]
- Przyborski SA, Morton IE, Wood A et al. Developmental regulation of neurogenesis in the pluripotent human embryonal carcinoma cell line NTERA-2. Euro J Neurosci 2000;12:35213528.[CrossRef][Medline]
- Lee VM, Andrews PW. Differentiation of NTERA-2 clonal human embryonal carcinoma cells into neurons involves the induction of all three neurofilament proteins. J Neurosci 1986;6:514521.[Abstract]
- Younkin DP, Tang CM, Hardy M et al. Inducible expression of neuronal glutamate receptor channels in the NT2 human cell line. Proc Natl Acad Sci USA 1993;90:21742178.[Abstract/Free Full Text]
- Rendt J, Erulkar S, Andrews PW. Presumptive neurons derived by differentiation of a human embryonal carcinoma cell line exhibit tetrodotoxin-sensitive sodium currents and the capacity for regenerative responses. Exp Cell Res 1989;180:580584.[CrossRef][Medline]
- Squires PE, Wakeman JA, Chapman H et al. Regulation of intracellular Ca2+ in response to muscarinic and glutamate receptor antagonists during the differentiation of NTERA2 human embryonal carcinoma cells into neurons. Eur J Neurosci 1996;8:783793.[CrossRef][Medline]
- Hartley RS, Margulis M, Fishman et al. Functional synapses are formed between Ntera2 (NT2N, hNT) neurons grown on astrocytes. J Comp Neurol 1999;407:110.[CrossRef][Medline]
- Wang K, Gan L, Jeffery E et al. Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray. Gene 1999;229:101108.[CrossRef][Medline]
- Rhee CH, Hess K, Jabbur J et al. cDNA expression array reveals heterogeneous gene expression profiles in three glioblastoma cell lines. Oncogene 1999;18:27112717.[CrossRef][Medline]
- Sehgal A, Boynton AL, Young RF et al. Application of the differential hybridization of Atlas Human expression arrays technique in the identification of differentially expressed genes in human glioblastoma multiforme tumor tissue. J Surg Oncol 1998;67:234241.[CrossRef][Medline]
- DeRisi J, Penland L, Brown PO et al. Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat Genet 1996;14:457460.[CrossRef][Medline]
- Kelly DL, Rizzino A. DNA microarray analyses of genes regulated during the differentiation of embryonic stem cells. Mol Reprod Dev 2000;56:113123.[CrossRef][Medline]
- Satoh JI, Kuroda Y. Differential gene expression between human neurons and neuronal progenitor cells in culture: an analysis of arrayed cDNA clones in NTERA2 human embryonal carcinoma cell line as a model system. J Neurosci Methods 2000;94:155164.[CrossRef][Medline]
- Andrews PW, Damjanov I, Simon D et al. Pluripotent embryonal carcinoma clones derived from the human teratocarcinoma cell line Tera-2: differentiation in vivo and in vitro. Lab Invest 1984;50:147162.[Medline]
- Pleasure SJ, Page C, Lee VM. Pure, post-mitotic, polarized human neurons derived from NTera2 cells provide a system for expressing exogenous proteins in terminally differentiated neurons. J Neurosci 1992;12:18021815.[Abstract]
- Fenderson BA, Andrews PW, Nudelman E et al. Glycolipid core structure switching from globo- to lacto- and ganglio-series during retinoic acid-induced differentiation of TERA-2 derived human embryonal carcinoma cells. Dev Biol 1987;122:2134.[CrossRef][Medline]
- Przyborski SA. Isolation of human embryonal carcinoma stem cells by immuno-magnetic sorting. STEM CELLS 2001;19:500504.[Abstract/Free Full Text]
- van Eijk MJT, van Rooijen MA, Modina S et al. Molecular cloning, genetic mapping and developmental expression of Bovine POU5F1. Biol Reprod 1999;60:10931103.[Abstract/Free Full Text]
- Wakeman JA, Walsh J, Andrews PW. Human Wnt-13 is developmentally regulated during the differentiation of NTERA-2 pluripotent human embryonal carcinoma cells. Oncogene 1998;17:179186.[CrossRef][Medline]
- Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor New York: Cold Spring Harbor Press, 1989.
- Fodor SP, Rava RP, Huang XC et al. Multiplexed biochemical assays with biological chips. Nature 1993;364:555556.[CrossRef][Medline]
- Fodor SP, Read JL, Pirrung MC et al. Light-directed, spatially addressable parallel chemical synthesis. Science 1991;251:767773.[Abstract/Free Full Text]
- Lockhart DJ, Dong H, Byrne MC et al. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat Biotechnol 1996;14:16751680.[CrossRef][Medline]
- Andrews PW, Goodfellow PN, Shevinsky LH et al. Cell-surface antigens of a clonal human embryonal carcinoma cell line: morphological and antigenic differentiation in culture. Int J Cancer 1982;29:523531.[Medline]
- Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000;24:372376.[CrossRef][Medline]
- Pera MJ, Reubinoff B, Trounson A. Human embryonic stem cells. J Cell Sci 2000;113:510.[Abstract]
- Ackerman SL, Knowles BB, Andrews PW. Gene regulation during neuronal and non-neuronal differentiation of NTERA2 human teratocarcinoma-derived stem cells. Mol Brain Res 1994;25:157162.[Medline]
- Giesberts AN, Duran C, Morton IN et al. The expression and function of cadherin-mediated cell-to-cell adhesion in human embryonal carcinoma cells. Mech Dev 1999;83:115125.[CrossRef][Medline]
- Mavilio F, Simeone A, Boncinelli E et al. Activation of four homeobox gene clusters in human embryonal carcinoma cells induced to differentiate by retinoic acid. Differentiation 1988;37:7379.[CrossRef][Medline]
- Simeone A, Acampora D, Arcioni L et al. Sequential activation of human HOX2 homeobox genes by retinoic acid in human embryonal carcinoma cells. Nature 1990;346:763766.[CrossRef][Medline]
- Sugimoto T, Hosoi H, Horii Y et al. Malignant rhabdoid-tumor cell line showing neural and smooth-muscle-cell phenotypes. Int J Cancer 1999;82:678686.[CrossRef][Medline]
- Wozney JM, Rosen V, Celeste AJ et al. Novel regulators of bone formation: molecular clones and activities. Science 1988;242:15281534.[Abstract/Free Full Text]
- Zhuo H, Hammonds RG Jr, Findlay DM et al. Retinoic acid modulation of mRNA levels in malignant, nontransformed, and immortalized osteoblasts. J Bone Miner Res 1991;6:767777.[Medline]
- Chi N, Epstein JA. Getting your Pax straight: Pax proteins in development and disease. Trends Genet 2002;18:4147.[CrossRef][Medline]
- Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:11451147.[Abstract/Free Full Text]
- Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000;18:399404.[CrossRef][Medline]
- Ciccodicola A, Dono R, Obici S et al. Molecular characterization of a gene of the EGF family expressed in undifferentiated human NTERA2 teratocarcinoma cells. EMBO J 1989;8:19871991.[Medline]
- Dono R, Montuori N, Rocchi M et al. Isolation and characterization of the CRIPTO autosomal gene and its X-linked related sequence. Am J Hum Genet 1991;49:555565.[Medline]
- Bani-Yaghoub M, Bechberger JF, Naus CCG. Reduction of connexin43 expression and dye-coupling during neuronal differentiation of human NTERA2/Clone D1 cells. J Neurosci Res 1997;49:1931.[CrossRef][Medline]
- Hirai H, Maru Y, Hagiwara K et al. A novel putative tyrosine kinase receptor encoded by the eph gene. Science 1987;238:17171720.[Abstract/Free Full Text]
- Tanaka S, Akiyoshi T, Mori M et al. A novel frizzled gene identified in human esophageal carcinoma mediates APC/beta-catenin signals. Proc Natl Acad Sci USA 1998;95:1016410169.[Abstract/Free Full Text]
- Umhauer S, Ruch RJ, Fanning J. Gap junctional intercellular communication and connexin 43 expression in ovarian carcinoma. Am J Obstet Gynecol 2000;182:9991000.[Medline]
- Tomasetto C, Regnier C, Moog-Lutz C et al. Identification of four novel human genes amplified and overexpressed in breast carcinoma and localized to the q11-q21.3 region of chromosome 17. Genomics 1995;28:367376.[CrossRef][Medline]
- Di Paolo G, Lutjens R, Osen-Sand A et al. Differential distribution of stathmin and SCG10 in developing neurons in culture. J Neurosci Res 1997;50:10001009.[CrossRef][Medline]
- McNeill TH, Mori N, Cheng HW. Differential regulation of the growth associated proteins, GAP-43 and SCG-10, in response to unilateral cortical ablation in adult rats. Neurosci 1999;90:13491360.[CrossRef][Medline]
- Przyborski SA, Cambray-Deakin MA. Developmental changes in GAP-43 expression in primary cultures of rat cerebellar granule cells. Mol Brain Res 1994;25:273285.[Medline]
- Przyborski SA, Cambray-Deakin MA. Heterogeneity of tau protein and mRNA expression during the development of cerebellar neurons in vitro. Brain Res Dev Brain Res 1995;87:2945.[CrossRef][Medline]
- Przyborski SA, Cambray-Deakin MA. Examination of microtubule-associated protein MAP2 during cerebellar granule neuron development in vitro. Dev Brain Res 1995;89:187201.[CrossRef][Medline]
- Ericson J, Rashbass P, Schedl A et al. Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signalling. Cell 1997;90:169180.[CrossRef][Medline]
- Walther C, Gruss P. Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 1991;113:14351449.[Abstract]
- Heins N, Malatesta P, Cecconi F et al. Glial cells generate neurons: the role of the transcription factor Pax6. Nat Neurosci 2002;5:308315.[CrossRef][Medline]
- Renoncourt Y, Carroll P, Filippi P et al. Neurons derived in vitro from ES cells express homeoproteins characterisitic of motoneurons and interneurons. Mech Dev 1998;79:185197.[CrossRef][Medline]
Received December 2, 2002;
accepted for publication April 30, 2003.
This article has been cited by other articles:

|
 |

|
 |
 
R. B. White and M. R. Ziman
Genome-wide discovery of Pax7 target genes during development
Physiol Genomics,
October 8, 2008;
33(1):
41 - 49.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Przyborski
Differentiation of Human Embryonic Stem Cells After Transplantation in Immune-Deficient Mice
Stem Cells,
September 1, 2005;
23(9):
1242 - 1250.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Sun, Y. Wang, H. Qing, M. A. Christensen, Y. Liu, W. Zhou, Y. Tong, C. Xiao, Y. Huang, S. Zhang, et al.
Distinct transcriptional regulation and function of the human BACE2 and BACE1 genes
FASEB J,
May 1, 2005;
19(7):
739 - 749.
[Abstract]
[Full Text]
[PDF]
|
 |
|
