Stem Cells http://www.peprotech.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gurevitch, O.
Right arrow Articles by Slavin, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gurevitch, O.
Right arrow Articles by Slavin, S.

Stem Cells 2003;21:588-597 www.StemCells.com
© 2003 AlphaMed Press

Reconstruction of Cartilage, Bone, and Hematopoietic Microenvironment with Demineralized Bone Matrix and Bone Marrow Cells

Olga Gurevitch, Basan Gowda S. Kurkalli, Tatyana Prigozhina, Judith Kasir, Anna Gaft, Shimon Slavin

Department of Bone Marrow Transplantation and Cancer Immunotherapy, Cell Therapy and Transplantation Biology Research Center, Hadassah University Hospital, Jerusalem, Israel

Key Words. Bone • Cartilage • Stromal microenvironment • Bone marrow • Demineralized bone matrix • Reconstruction

Shimon Slavin, M.D., Head, Department of Bone Marrow Transplantation & Cancer Immunotherapy, Hadassah University Hospital, P.O.B. 12000, Jerusalem 91120, Israel. Telephone: 972–2–6776561; Fax: 972–2–6422731; e-mail: slavin{at}cc.huji.ac.il.


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Highly specialized hard tissues, such as cartilage, bone, and stromal microenvironment supporting hematopoiesis, originate from a common type of mesenchymal progenitor cell (MPC). We hypothesized that MPCs present in bone marrow cell suspension and demineralized bone matrix (DBM) that possess natural conductive and inductive features might constitute a unit containing all the essential elements for purposive bone and cartilage induction. Using a rodent preclinical model, we found that implantation of a composite comprising DBM and MPCs into A) a damaged area of a joint; B) an ablated bone marrow cavity, and C) a calvarial defect resulted in the generation of A) a new osteochondral complex comprising articular cartilage and subchondral bone; B) trabecular bone and stromal microenvironment supporting hematopoiesis, and C) flat bone, respectively. The new tissue formation followed differentiation pathways controlled by site–specific physiological conditions, thus developing tissues that precisely met local demands.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The purposive development of hard tissues in the postnatal mammalian organism is indicated in a wide range of clinical conditions, including either bone and cartilage repair following trauma, congenital or acquired lesions secondary to infection or inflammatory conditions and surgical procedures, or, alternatively, for establishment of a hematopoietic microenvironment. All highly specialized types of hard tissues, including cortical and trabecular bone, tendons, ligaments, and different kinds of cartilage as well as a stromal microenvironment supporting and regulating hematopoiesis, originate from a common type of early mesenchymal progenitor cell (MPC) [1–6], that is widely distributed throughout the organism. MPCs are abundant in the hard tissues, bone marrow, skin, brain, muscle, and probably exist in small numbers elsewhere as well [7–9]. Progenitor cells present in the bone marrow of rodents are especially well characterized [10, 11]. However, although early progenitor cells are ubiquitous, damaged hard tissues do not repair spontaneously. Various attempts have been made to transplant bone, cartilage, or purified and cultured MPCs into the sites of bone and cartilage defects with promising, yet limited, success [12–15].

Currently, autologous bone and cartilage are the most common graft materials used. However, the applicability of autografts is problematic because of their limited size and shape and the risk of donor site morbidity and infection. Another possible limiting factor is the low number of MPCs with high proliferative potential present in differentiated bone or cartilage implants. Transplantation of cultured autologous chondrocytes or mesenchymal cells is cumbersome and expensive, involving a three–stage procedure that includes harvesting, culturing, and implantation. Furthermore, the tissue produced possesses suboptimal biomechanical properties. On the other hand, the alternatively used bone and cartilage allografts, as well as cultured allogeneic chondrocytes or mesenchymal cells, are immunogenic, thus requiring lifelong use of potentially hazardous immunosuppressive agents. Bone marrow stimulation techniques such as abrasion arthroplasty, drilling, and microfracture produce only fibrocartilage and therefore do not offer a long–term cure [12]. The most successful application of microfracture techniques reported by Steadman and coworkers was a slow process leading to functional improvement within 6 months to 2 years. Consequently, a complex rehabilitation program is crucial to optimize the conditions for development of articular cartilage–like cells [16].

Taken together, the purposive induction of local hard tissue development is still a problematic issue and better solutions are urgently needed. In view of the difficulties involved in the purposive induction of local hard tissue development by tissue grafting or transplantation of MPCs, and wide acceptance of the concept that MPCs need to be adequately induced and conducted to accomplish new tissue development [17], we sought an efficient combination of an optimal MPC source with the appropriate carrier. We chose bone marrow as a rich, easily and safely available source of MPCs, and demineralized bone matrix (DBM), which combines all the necessary conductive features of a carrier, serving at the same time as a natural source of inductive osteo– and chondrogenic factors such as bone morphogenetic proteins (BMPs) [18–20]. In addition, DBM is slowly biodegradable and nonimmunogenic [21–23]. We assumed that MPCs present in bone marrow cells (BMCs) aspirate, and DBM, possessing natural conductive and inductive features, would constitute a self–sufficient unit containing all the essential elements for local formation of hard tissue in orthotopic or ectopic sites. Transplantation of DBM together with BMCs was shown to stimulate osteogenic repair in nonunions of fractures and segmental defects [24–28]. Our working hypothesis tested in the present research was that a composite comprising DBM and BMCs (DBM/BMC) might be capable of developing different kinds of hard tissues such as cortical and trabecular bone, articular cartilage, and stromal microenvironment supporting hematopoiesis according to local conditions at the site of transplantation.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Male Lewis rats weighing 180–200 g were used as bone donors for matrix preparation and BMCs. Female Lewis rats were used as graft recipients (at least six animals per group). The study was conducted in compliance with the international laws on animal experimentation and approved by the Ethical Committee of the Hebrew University Medical School.

Preparation of DBM
DBM was prepared as previously described [29]. Diaphyseal cortical bone cylinders were crumbled and placed in a jar under magnetic stirring. Bone chips were rinsed in distilled water for 2–3 hours, in ethanol (70%, 96%, and 100%, consecutively) for 1 hour, and in diethyl ether for 0.5 hour, then dried under a laminar flow hood, pulverized in a mortar with liquid nitrogen, and sieved to select particles between 300–450 microns. The powder obtained was demineralized in 0.6 M hydrochloride overnight, washed to remove the acid, dehydrated in ethanol and diethyl ether, and dried. All the procedures were performed at 4°C to prevent degradation of BMPs by endogenous proteolytic enzymes. The resultant DBM was stored at -20°C.

Composition of the Grafts
The DBM/BMC composite consisted of 20 µl of unmanipulated BMC suspension at a concentration 3 x 108 cells/ml and 4 mg of DBM, with particles 300–450 microns in size. Ingredients were mixed extemporaneously prior to application in vivo.

Implantation of DBM/BMC Composite into an Experimentally Created Calvarial Defect
Under general anesthesia, an incision was made in the frontal region of the rat cranium. A full thickness bone defect (6 x 6 mm2) was created laterally to the sagittal suture using a dental burr. The defect area was either left empty, filled with DBM or BMC alone, or filled with DBM/BMC. The defect area was then covered with fibrin glue; the skin flap was returned into place and fixed with stainless steel clips.

Implantation of DBM/BMC Composite into Damaged Articular Cartilage and Subchondral Bone of the Knee Joint
The knee joint of anesthetized recipients was accessed through a medial parapatellar incision, and the patella was temporarily displaced laterally. A microfracture aiming for a full thickness defect of 1.5 mm in diameter and 2.0 mm in depth was drilled in the intercondylar region of the femur. The defect was either left empty, filled with DBM or BMC alone, or filled with DBM/BMC. The defect area was then covered with fibrin glue, the patella was returned to normal position, and the incision was sutured with bioresorbable thread. The skin was closed with stainless steel clips.

Implantation of DBM/BMC Composite into the Locally Irradiated and Ablated Medullary Cavity of the Bone
Rats were anesthetized, and their right leg was irradiated with 1,000 cGy. Radiation was delivered by a Phillips x–ray unit (250 kV, 20 mA) at a rate of 70 cGy/minute using a Cu 0.2–mm filter. The source–to–skin distance was 40 cm. Following irradiation, a hole 1.5 mm in diameter was drilled in the intercondylar region of the femur as described above. The content of the femoral medulla was evacuated with a 16–gauge bone marrow aspiration needle. The bone marrow cavity was flushed with phosphate–buffered saline and the desired material was implanted. The hole was covered with fibrin glue, and the wound was closed as described above. Commercial bone morphogenetic protein (BMP2; R & D Systems; Minneapolis, MN; http://www.rndsystems.com) was used to facilitate the function of DBM/BMC.

Analysis of Tissue Samples with Laser Capture Microdissection and Polymerase Chain Reaction
Male BMCs were transplanted with DBM into female recipients, and the newly formed articular cartilage, cranial and trabecular bone, and hematopoietic tissue repopulating the newly established trabecular bones were checked by polymerase chain reaction (PCR) analysis to confirm the source of the reconstructed tissues at the site of the defect. The new laser capture microdissection (LCM) technology that allows isolation of individual cells from tissue sections under precise microscopic control was used to identify the source of cells (about 100–300 cells per test). PCR analysis was performed using a set of primers specific to the rat Sry gene, the sex determination region of the Y chromosome, with the following sequence: 5' primer: 5'–CATCGAAGGGTTAAAGTG CCA–3', 3' primer: 5'–TGCAGCTCTACTCCAGTCTTG–3'. The product is a 136 base pair DNA fragment [30].

Histological Evaluation
Tissues obtained at autopsy were fixed in 4% neutral buffered formaldehyde, decalcified, passed through a series of ethanol grades and xylene, and embedded in paraffin. Sections (5–7 microns thick) were stained with picroindigocarmin.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Bone Repair in Critical Size Calvarial Defect
No bone regeneration was observed 15 and 30 days after creation of a full–thickness cranial bone defect (Fig. 1B a, d, g, and jGo) in 100% of the experimental animals. This suggests that the defect could be defined as nonhealing. Filling the defect with BMC alone also failed to result in bone regeneration (data not shown). When fibrin glue was added to BMC, small islands of thin bone developed in about 50% of the cases since transplanted BMC are kept together and their migration out of the transplantation site is prevented (Fig. 1AGo). It seems most probable that in the absence of osteoinductive and osteoconductive influences of DBM, mesenchymal stem cells could not be effectively induced into osteogenesis, thus only predifferentiated (restricted to osteochondrogenesis) progenitor cells existing in the transplanted BMC were engaged in bone formation.



View larger version (89K):
[in this window]
[in a new window]
  		Figure 1. Restoration of parietal bone defect by transplantation of DBM/BMC composite.A) X–ray and photomacrographs of coronary cranial sections 30 days after creation of full–thickness bone defect followed by transplantation of DBM/BMC (a) and BMC alone (b). B) Photomicrographs (2x and 10x) of coronary cranial sections 15 and 30 days after creation of full–thickness bone defect (6 x6 mm2) (Pic staining). a, d, g, j: No new bone formation when the site of parietal bone defect is left empty. b, e, h, k: Development of new bone is more active close to the edges of the damaged area when the site of missing bone was filled with DBM alone. c, f, i, l: Extensive bone development and full repair of the defect after transplantation of DBM/BMC composite. Note uniform bone formation in case of DBM/BMC composite transplantation when compared with transplantation of DBM alone. DA = defect area; CE = cut edge.

 
Implantation of DBM alone resulted in new hypoplastic and nonuniform bone formation throughout the defect area, accompanied by gradual degeneration and remodeling of DBM particles (Fig. 1B b, e, h, and k). The process was noticeably active close to the edges of the damaged cranial bone and very poorly discernible in the center of the defect, suggesting that proximity of DBM to the source of MPCs provided by the exposed bone at the junction of the surgical cut was important. In sharp contrast, when the BMC/DBM composite was transplanted into the experimental cranial defect, extensive remodeling of transplanted DBM particles and active new bone formation were presented uniformly throughout the entire defect area in all the experimental animals (Figs. 1A and 1B c, f, i, and lGo), and within 30 days after transplantation, the cut edges of the parietal bone could hardly be distinguished from the surrounding new bony tissue. This suggests that both DBM particles and MPCs provided by the BMC were necessary and sufficient for complete and normal restoration of the primary defect.

Repair of a Microfracture in the Articular Surface of the Knee Joint
Transplantation of DBM/BMC into a drilled hole in the osteochondral complex resulted in complete restoration of the defect. Extensive proliferation of chondrocytes surrounding the implanted DBM particles was observed 2–4 weeks after transplantation (Fig. 2I and 2JGo). After two months, subchondral bone was fully regenerated while the surface of the damaged area was covered by a thick and continuous layer of newly formed young hyaline cartilage (Fig. 2KGo). Six months after transplantation of DBM/BMC, the histology of the regenerated osteochondral complex was completely normal (Fig. 2LGo). In contrast, when a full–thickness microfracture drilled in the osteochondral complex of the rat femur was left empty, it did not show proper regeneration. Two weeks after drilling, the hole was filled with connective tissue (Fig. 2EGo). Within 6 months the subchondral bone was repaired; however, the surface of the damaged area was composed of fibrocartilagenous or connective tissue (Fig. 2FGo). Penetration into the subchondral bone seemed to provide the damaged area with locally leaking bone marrow cells. Hence, it seems reasonable that implantation of exogenous BMCs alone did not result in any considerable change in the pattern of spontaneous regeneration (data not shown).



View larger version (88K):
[in this window]
[in a new window]
  		Figure 2. Restoration of damaged osteochondral complex in the knee joint by transplantation of DBM/BMC composite. Photomicrographs (2x and 10x) of longitudinal knee joint sections after creation of full–thickness osteochondral defect (Pic staining). A–C) General view (A) and osteochondral articular complex (B, C) of the normal rat knee joint. D) Full thickness microfracture. E, F) Restoration of the untreated defect. Two weeks after drilling, the microfracture is filled with connective tissue (E). At 6 months the subchondral bone is repaired, while the surface of the damaged area is constituted of connective tissue and fibrocartilage (F). G, H) Restoration of the defect after DBM transplantation. No actively proliferating cells or visible DBM remodeling at 2 weeks after treatment (G), though after 6 months subchondral bone is completely repaired and the damaged area is covered with connective tissue and fibrocartilage (H). I–L) Restoration of the defect after transplantation of DBM/BMC composite. Extensive proliferative chondrocytes surrounding gradually degraded DBM particles 2–4 weeks after transplantation (I, J). Regenerated subchondral bone and continuous layer of young hyaline cartilage 2 months after transplantation (K). Normal histology of the regenerated osteochondral complex 6 months after transplantation (L). DA = defect area.

 
When DBM particles alone were transplanted into the drilled hole, proper healing of the defect was not observed either. No active chondrocyte production was seen at 2 weeks after transplantation (Fig. 2GGo), which gives rise to the assumption that the number of locally available MPCs was not sufficient for effective regeneration of the osteochondral complex. In most cases, the degradation and remodeling of DBM particles, as well as the process of new bone and cartilage formation, was slow and inefficient, although the subchondral bone was finally repaired and the damaged area covered with connective and fibrocartilagenous tissue (Fig. 2HGo). Successful regeneration of the osteochondral complex after DBM/BMC transplantation depended in part on the technical success of the operation (i.e., successful packing and fixation of the graft in the damaged area). However, excluding these factors, the beneficial effect of the DBM/BMC was very consistent. No complete cure was seen in untreated controls or controls treated with either of the components alone.

Reconstitution of Femoral Medullary Cavity Contents After Local Irradiation and Mechanical Ablation
Irradiation in combination with the physical ablation of the medullary cavity considerably reduced the number of both mesenchymal and hematopoietic progenitor cells. This created favorable conditions for de novo development of the entire osteohematopoietic complex produced by donor BMCs. Moreover, irradiation of the recipient bone marrow compartment simulated the condition established in candidates for bone marrow transplantation conditioned with myeloablative chemoradiotherapy, and proved that replacement of both hematopoietic tissue and its stromal microenvironment is indeed feasible.

At 2 and 4 weeks after intraosseous transplantation of DBM/BMC into the ablated medullary cavity of the locally irradiated femur, extensive degradation and remodeling of DBM particles, formation of new bone trabeculae, and progressive development of hematopoietic tissue were observed (Fig. 3B and 3DGo). The addition of 0.5 µg BMP2 to the DBM/BMC graft accelerated the development of the osteohematopoietic complex (Fig. 3C and 3EGo), and only small particles of DBM were observed in the femoral shaft 30 days after transplantation. Two months after intrafemoral transplantation of DBM/BMC, the new osteohematopoietic complex was undistinguishable from that of the intact femur (Fig. 3F and 3IGo, respectively). Normal self–maintenance of the newly formed complex was confirmed at 5 and 12 months after transplantation of DBM/BMC composite (Fig. 3G and 3HGo). In contrast, when the ablated marrow cavity was left empty, there was no extensive regeneration of the intramedullary osteohematopoietic complex. At 2 weeks after ablation, the intramedullary space was filled predominantly with connective tissue (Fig. 3JGo), while subsequent regeneration of the osteohematopoietic complex was slow and inefficient. Intrafemoral implantation of DBM without BMC was also not efficient; almost no remodeling of DBM particles and hematopoietic tissue regeneration was observed at 2 weeks after transplantation (Fig. 3KGo). Bone tissue that subsequently developed in the femoral cavity was thick with poor remodeling potential and formation of a new trabecular system was slow, proving that the number of locally available hematopoietic progenitor cells was insufficient for effective regeneration of the intraosseous osteohematopoietic complex. Intraosseous transplantation of BMC alone resulted in regeneration of the contents of the bone marrow cavity. However, as it is already well known, the stromal compartment of regenerated osteohematopoietic complex following conventional transplantation of BMC remains of recipient origin, whereas, as shown below, we have documented a population of hosts with donor stroma produced by transplanted cells interacting with DBM.



View larger version (71K):
[in this window]
[in a new window]
  		Figure 3. Reconstitution of locally irradiated and mechanically ablated femoral medullary cavity contents by transplantation of DBM/BMC composite. Photomicrographs (2x and 10x) of longitudinal knee joint sections after creation of full–thickness osteochondral defect (Pic staining). A) Immediately after irradiation and ablation. B, D) Extensive degradation and remodeling of DBM particles, formation of new bone trabeculas, and progressive development of hematopoietic tissue 2 (B) and 4 (D) weeks after intraosseous transplantation of DBM/BMC. C, E) Development of the osteohematopoietic complex 2 (C) and 4 (E) weeks after transplantation of DBM/BMC graft supplemented with BMP2. Note accelerated bone remodeling and development of hematopoietic tissue. F–I) 2 (F), 5 (G), and 12 (H) months after DBM/BMC transplantation, the femoral cavity contents are indistinguishable from that of the intact femur (I). J) Medullary cavity filled with connective tissue at 2 weeks after ablation not followed with transplantation. K) Almost no production of new bone or hematopoietic tissue at 2 weeks after implantation of DBM without BMC.

 
Determination of the Origin of the Newly Developing Bone, Articular Cartilage, and Hematopoietic Tissue after Implantation of DBM/BMC Composite
Male BMC mixed with DBM was implanted in syngeneic female rats. PCR analysis of cells captured by LCM from the newly developed parietal bone (Fig. 4Go), articular cartilage, subchondral bone and hematopoietic tissue from the newly developed osteochondral complex (Fig. 5Go), as well as trabecular bone and hematopoietic tissue from the regenerated medullary cavity (Fig. 6Go) confirmed the presence of donor–derived cells.



View larger version (99K):
[in this window]
[in a new window]
  		Figure 4. LCM and PCR analysis of cells obtained from newly formed parietal bone produced by donor male cells in a female recipient. A–C) Photomicrographs of coronary sections through the area of new bone formation. General view (A) (Pic staining), target area for LCM (B), laser shots (C). D) Cells captured for PCR analysis. E) PCR product (a 136–bp fragment) detection by agarose gel electophoresis. (1) DNA marker (fX174 DNA/Hae III); (2) New bone DNA; (3) control male DNA. CE = cut edge; NB = new bone.

 


View larger version (93K):
[in this window]
[in a new window]
  		Figure 5. LCM and PCR analysis of cells obtained from newly formed osteochondral complex produced by donor male cells in a female recipient. A, B, C, E, F, H, I) Photomicrographs of longitudinal sections through the area of newly formed tissue. General view (A) (Pic staining), target areas of cartilage (B), bone marrow (E), and trabecular bone (H) for LCM. Laser shots in cartilage (C), bone marrow (F), and trabecular bone (I). D, G, J) Cells captured for PCR analysis from cartilage, bone marrow, and trabecular bone, respectively. K) PCR product (a 136–bp fragment) detection by agarose gel electophoresis. (1) DNA marker (fX174 DNA/Hae III); (2) DNA from new cartilage; (3) New subchondral bone DNA; (4) New bone marrow DNA; (5) Control male DNA.

 


View larger version (48K):
[in this window]
[in a new window]
  		Figure 6. LCM and PCR analysis of cells obtained from newly formed osteohematopoietic complex produced by donor male cells in a female recipient. A, B, C, E, F) Photomicrographs of longitudinal sections through the area of newly formed tissue in femoral marrow cavity. General view (A) (Pic staining), target areas of trabecular bone (B), and bone marrow (E) for LCM. Laser shots in trabecular bone (C) and bone marrow (F). D, G) Cells captured for PCR analysis from trabecular bone and bone marrow, respectively. H) PCR product (a 136–bp fragment) detection by agarose gel electophoresis. (1) DNA marker (fX174 DNA/Hae III); (2) New bone DNA; (3) New bone marrow DNA; (4) Control male DNA.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Previously, we have shown that osteohematopoietic sites ectopically induced by implantation of DBM possess the same main features as skeletal bones as far as self–maintenance of the bone, support of hematopoietic stem cells, and normal three–lineage hematopoiesis [29,31]. Using the nonunion defect model, transplantation of DBM together with BMC was also shown to stimulate osteogenic repair [24–28].

In the present work, we have demonstrated that MPC present in fresh, unmanipulated cell suspension derived from bone marrow, and DBM that possesses natural inductive and conductive features, constitute a self–sufficient unit containing all the essential elements for local formation of articular cartilage, cortical and trabecular bone, and stromal microenvironment supporting hematopoiesis in orthotopic or ectopic sites. Newly formed osteohematopoietic sites produced by the DBM/BMC composite proved to continue self–maintenance and proper function throughout an observation period of 12 months, corresponding to half the life–span of the experimental mammal. Following the transplantation of DBM/BMC composite into missing areas of parietal bone, damaged osteochondral complex of the knee joint, or the ablated medullary cavity of the femoral bone, our most remarkable observation was that the pattern of reconstruction was controlled by the physiological conditions at the anatomical site of the implant. New tissue formation followed site–specific differentiation pathways, thus producing different types of bone and cartilage that precisely met local demands. When transplanted into the ablated bone shaft, the DBM/BMC complex produced bone trabeculae and stromal microenvironment supporting hematopoiesis, whereas at the damaged calvarium, DBM/BMC composite produced a flat bone indistinguishable from normal flat bone. In the knee joint, transplantation of the same DBM/BMC composite resulted in the formation of normal subchondral bone at the depth of the damaged site and articular cartilage in the free joint surface in contact with synovial membranes and synovial fluid.

It is not yet clear what drives MPC toward osteogenic and chondrogenic differentiation pathways. It has been reported that the ratio of cartilage to bone production depends on the site of DBM implantation, which is naturally influenced by local environmental conditions [9], such as the local source of MPC and blood supply [32]. However, in our experimental models, the DBM/BMC composite grafted into different sites was identical, including fresh unmanipulated BMC suspension as the source of MPC. Thus, local conditions at the site of transplantation represented the only variable component influencing the MPC in the DBM/BMC composite. Low oxygen tension, for example, was shown to favor chondrogenesis [33], most likely due to the low O2 tension in poorly vascularized cartilage [34]. Taking into consideration the fact that hyaline cartilage is naturally developed and maintained only in the joints where there is no direct blood supply but where contact with synovial membranes and lubrication with synovial fluid is available, it seems reasonable to assume that these specific environmental conditions play a major role in the development of articular cartilage. In support of the assumption that development of highly specialized cells and tissues depends on local environmental influences is the successful substitution of the anterior cruciate ligament by a strip of demineralized cortical bone matrix reported in a goat model [35]. The remodeling process included new bone formation within the matrix in the osseous tunnels and a ligament–like transition zone developing at the extra–articular tunnel interface.

Despite the fact that the specific mechanisms responsible for regulation of the differentiation pathways in the process of local production of hard tissues have not yet been fully ascertained, it seems reasonable to suggest that therapeutic procedures based on the DBM/BMC composite may be clinically applicable to correct various hereditary and acquired bone and cartilage disorders; traumatic injuries; arthropathies secondary to inflammatory, autoimmune, infectious, or metabolic diseases; and for bone replacement following trauma or surgical procedures.

Theoretically, transplantation of DBM/BMC composite, but not DBM alone, should be applicable at sites where there are no, or insufficient, local MPCs (i.e., where the bone deficit is large or whenever the surrounding tissues are MPC poor). In fact, with the exclusion of simple fractures, a low number of MPCs is the most common limiting factor for bone regeneration.

Further optimization of the properties of the DBM/BMC composite may be accomplished in the future by adding BMPs, as already suggested by our limited experience with BMP2 that accelerated the development of the osteohematopoietic complex. Taking into consideration that demineralized bone is the natural source of BMPs, it can be assumed that additional supplementation of BMPs may improve the quality of osteogenesis and, accordingly, enhance hematopoiesis. Likewise, osteogenic growth peptide previously shown to enhance development of bone [36] and stromal microenvironment supporting hematopoiesis [37], and perhaps other factors stimulating MPCs and osteogenesis, may also facilitate local development of hard tissues. In addition, clinical application of DBM/BMC composite may be improved in the future by provision of mechanical properties to the implant that may be essential to temporarily meet the requirements of the organism throughout the period of recovery and tissue regeneration (manuscript in preparation).

We have demonstrated here that transplantation of BMCs, which contain both hematopoietic and mesenchymal progenitor cells, together with DBM results in the development of bone and stromal microenvironment supporting hematopoiesis. As can be seen in Figure 3Go, the distribution of DBM particles throughout the femoral cavity was not absolutely even, and areas of tightly packed DBM particles surrounded by new bone tissue formed mostly in the middle of the shaft and were eventually remodeled. Newly formed stromal microenvironment is subsequently populated with hematopoietic progenitor cells also contained in the BMC of the same composite graft, resulting in construction of an entire osteohematopoietic organ consisting of bone and stromal microenvironment that supports normal differentiation of immunohematopoietic cells, all originating from donor–derived BMCs. We predict, on the basis of our data, that the DBM/BMC composite may be used to replace abnormal stromal microenvironment for the repair of hematopoietic tissue in bone marrow cavity, in a one–step procedure. A most interesting point for future consideration is the quality of the immune system formed de novo by bone marrow cells reconstituting in newly formed microenvironment, since this aspect may determine the potential future role of the intraosseous bone marrow transplantation procedure in clinical practice.

Taken together, the methodology proposed may open a whole range of treatment opportunities for clinically relevant conditions such as restoration of bones and joints damaged by trauma, pathologic conditions, or surgical procedures and improvement of the engraftment capacity of autologous and allogeneic hematopoietic stem cells in patients with a defective stromal microenvironment. Preclinical and preliminary clinical trials confirming the efficacy of BMC/DBM composite for the proposed indications are currently under way and will be reported separately.


   ACKNOWLEDGMENT
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We wish to thank the Danny Cunniff Leukemia Research Laboratory, The Gabrielle Rich Leukemia Research Foundation, The Cancer Treatment Research Foundation, The Novotny Trust, The Szydlowsky Foundation, The Fig Tree Foundation, and Ronne and Donald Hess for their continuous support of our ongoing basic and clinical research.


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Caplan AI. Mesenchymal stem cells. J Orthop Res 1991;9:641–650.[CrossRef][Medline]

  2. Prockop DJ. Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 1997;276:71–74.[Abstract/Free Full Text]

  3. Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.[Abstract/Free Full Text]

  4. Gurevich O, Vexler A, Marx G et al. Fibrin microbeads for isolating and growing bone marrow–derived progenitor cells capable of forming bone tissue. Tissue Eng 2002;8:661–672.[CrossRef][Medline]

  5. Krause DS, Theise ND, Collector MI et al. Multi–organ, multi–lineage engraftment by a single bone marrow–derived stem cell. Cell 2001;105:369–377.[CrossRef][Medline]

  6. Bianchi G, Muraglia A, Daga A et al. Microenvironment and stem properties of bone marrow–derived mesenchymal cells. Wound Repair Regen 2001;9:460–466.[CrossRef][Medline]

  7. Urist MR, Dowell TA, Hay PH et al. Inductive substrates for bone formation. Clin Orthop 1968;59:59–96.[Medline]

  8. Reddi AH, Huggins C. Biochemical sequences in the transformation of normal fibroblasts in adolescent rats. Proc Natl Acad Sci USA 1972;69:1601–1605.[Abstract/Free Full Text]

  9. Inoue T, Deporter DA, Melcher AH. Induction of chondrogenesis in muscle, skin, bone marrow, and periodontal ligament by demineralized dentin and bone matrix in vivo and in vitro. J Dent Res 1986;65:12–22.[Abstract/Free Full Text]

  10. Owen M, Friedenstein AJ. Stromal stem cells: marrow–derived osteogenic precursors. Ciba Foundation Symposium 1988;136:42–60.[Medline]

  11. Aubin JE, Herbertson A. Osteoblast lineage in experimental animals. In: Bresford JN, Owen ME, eds. Marrow Stromal Stem Cells in Culture. Cambridge, UK: Cambridge University Press, 88–110.

  12. Gilbert JE. Current treatment options for the restoration of articular cartilage. Am J Knee Surg 1998;11:42–46.[Medline]

  13. Temenoff JS, Mikos AG. Review: tissue engineering for regeneration of articular cartilage. Biomaterials 2000;21:431–440.[CrossRef][Medline]

  14. Buckwalter JA, Mankin HJ. Articular cartilage: degeneration and osteoarthritis, repair, regeneration, and transplantation. Instr Course Lect 1998;47:487–504.[Medline]

  15. Stocum DL. Regenerative biology and engineering: strategies for tissue restoration.Wound Repair Regen 1998;6:276–290.[CrossRef][Medline]

  16. Steadman JR, Rodkey WG, Rodrigo JJ. Microfracture: surgical technique and rehabilitation to treat chondral defects. Clin Orthoped 2001;391(suppl 391):362–369.

  17. Oreffo RO, Triffitt JT. Future potentials for using osteogenic stem cells and biomaterials in orthopedics. Bone 1999;25(suppl 2):5S–9S.[CrossRef]

  18. Schmitt JM, Hwang K, Winn SR et al. Bone morphogenetic proteins: an update on basic biology and clinical relevance. J Orthop Res 1999;17:269–278.[CrossRef][Medline]

  19. Sampath TK, Reddi AH. Homology of bone-inductive proteins from human, monkey, bovine, and rat extracellular matrix. Proc Natl Acad Sci USA 1983;80:6591–6595.[Abstract/Free Full Text]

  20. Bessho K, Tagawa T, Murata M. Comparison of bone matrix-derived bone morphogenetic proteins from various animals. J Oral Maxillofac Surg 1992;50:496–501.[Medline]

  21. Torricelli P, Fini M, Rocca M et al. Xenogenic demineralized bone matrix: osteoinduction and influence of associated skeletal defects in heterotopic bone formation in rats. Int Orthop 1999;23:178–181.[CrossRef][Medline]

  22. Richardson CR, Mellonig JT, Brunsvold MA et al. Clinical evaluation of Bio-Oss: a bovine-derived xenograft for the treatment of periodontal osseous defects in humans. J Clin Periodontol 1999;26:421–428.[CrossRef][Medline]

  23. Block JE, Poser J. Does xenogeneic demineralized bone matrix have clinical utility as a bone graft substitute? Med Hypotheses 1995;45:27–32.[CrossRef][Medline]

  24. Tiedeman JJ, Garvin KL, Kile TA et al. The role of a composite, demineralized bone matrix and bone marrow in the treatment of osseous defects. Orthopedics 1995;18:1153–1158.[Medline]

  25. Tiedeman JJ, Connolly JF, Strates BS et al. Treatment of nonunion by percutaneous injection of bone marrow and demineralized bone matrix. An experimental study in dogs. Clin Orthop 1991;268:294–302.

  26. Connolly JF. Injectable bone marrow preparations to stimulate osteogeneic repair. Clin Orthop 1995;313:8–18.

  27. Gebhart M, Lane J. A radiographical and biomechanical study of demineralized bone matrix implanted into a bone defect of rat femurs with and without bone marrow. Acta Orthop Belg 1991;57:130–143.

  28. Tiedeman JJ, Huurman WW, Connolly JF et al. Healing of a large nonossifying fibroma after grafting with bone matrix and marrow. A case report. Clin Orthop 1991;265:302–305.

  29. Gurevitch OA. The ability of induced osteo-progenitor cells to maintain and rebuild long-term ectopic osteo-hematopoietic foci in vitro. Int J Cell Cloning 1990;8:130–137.[Abstract]

  30. An J, Beauchemin N, Albanese J et al. Use of a rat cDNA probe specific for the Y chromosome to detect male-derived cells. J Androl 1997;18:289–293.[Abstract/Free Full Text]

  31. Gurevitch O, Fabian I. Ability of the hemopoietic microenvironment in the induced bone to maintain the proliferative potential of early hemopoietic precursors. STEM CELLS 1993;11:56–61.[Abstract]

  32. Reddi AH, Huggins CB. Influence of geometry of transplanted tooth and bone on transformation of fibroblasts. Proc Soc Exp Biol Med 1973;143:634–637.[Medline]

  33. Sledge CB. Some morphologic and experimental aspects of limb development. Clin Orthop 1966;44:241–264.[Medline]

  34. Brighton CT, Heppenstall RB. Oxygen tension in zones of the epiphyseal plate, the metaphysis and diaphysis. An in vitro and in vivo study in rats and rabbits. J Bone Joint Surg Am 1971;53:719–728.[Abstract/Free Full Text]

  35. Jackson DW, Simon TM, Lowery W et al. Biologic remodeling after anterior cruciate ligament reconstruction using a collagen matrix derived from demineralized bone. An experimental study in the goat model. Am J Sports Med 1996;24:405–414.[Abstract/Free Full Text]

  36. Bab I, Gazit D, Chorev M et al. Histone H4-related osteogenic growth peptide (OGP): a novel circulating stimulator of osteoblastic activity. EMBO J 1992;11:1867–1873.[Medline]

  37. Gurevitch O, Slavin S, Muhlrad A et al. Osteogenic growth peptide increases blood and bone marrow cellularity and enhances engraftment of bone marrow transplants in mice. Blood 1996;88:4719–4724.[Abstract/Free Full Text]

Received April 14, 2003; accepted for publication June 16, 2003.



This article has been cited by other articles:


Home page
 Br. J. Radiol.Home page
I B Resnick and S Slavin
Lessons from bone marrow transplantation for a victim of a radiological accident with acute radiation syndrome
Br. J. Radiol., January 1, 2005; Supplement_27(1): 21 - 25.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gurevitch, O.
Right arrow Articles by Slavin, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gurevitch, O.
Right arrow Articles by Slavin, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS
http://www.stemcellsportal.com/