Stem Cells http://www.peprotech.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hay, D. C.
Right arrow Articles by Burdon, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hay, D. C.
Right arrow Articles by Burdon, T.

Stem Cells 2004;22:225-235 www.StemCells.com
© 2004 AlphaMed Press

Oct-4 Knockdown Induces Similar Patterns of Endoderm and Trophoblast Differentiation Markers in Human and Mouse Embryonic Stem Cells

David C. Hay, Linda Sutherland, John Clark, Tom Burdon

Department of Gene Expression and Development, Roslin Institute, Roslin, Midlothian, Scotland, United Kingdom

Key Words. Endoderm • ES cells • Oct-4 • Pluripotency • Trophoblast

Tom Burdon, Ph.D., Roslin Institute, Roslin, Midlothian, EH25 9PS Scotland, United Kingdom. Telephone: 00-44-131-527-4270; Fax: 00-44-131-440-0434; e-mail: tom.burdon{at}bbsrc.ac.uk; website: www.ri.bbsrc.ac.


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The transcription factor Oct-4 is a marker of pluripotency in mouse and human embryonic stem (ES) cells. Previous studies using a tetracycline-regulated Oct-4 transgene in the ZHBTc4 cell line demonstrated that downregulation of Oct-4 expression induced dedifferentiation into trophoblast, a lineage mouse ES cells do not normally generate. We found that transfection of Oct-4-specific short interfering RNA significantly reduced expression and functional activity of Oct-4 in mouse and human ES cells, enabling its role to be compared in both cell types. In mouse ES cells, Oct-4 knockdown produced a pattern of morphological differentiation and increase in expression of the trophoblast-associated transcription factor Cdx2, similar to that triggered by suppressing the Oct-4 transgene in the ZHBTc4 cell line. In addition, downregulation of Oct-4 was accompanied by increased expression of the endoderm-associated genes Gata6 and {alpha}-fetoprotein, and a gene trap associated with primitive liver/yolk sac differentiation. In human ES cells, Oct-4 knockdown also induced morphological differentiation coincident with the upregulation of Gata6. The induction of Cdx2 and other trophoblast-associated genes, however, was dependent on the culture conditions. These results establish the general requirement for Oct-4 in maintaining pluripotency in ES cells. Moreover, the upregulation of endoderm-associated markers in both mouse and human ES cells points to overlap between development of trophoblast and endoderm differentiation.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Embryonic stem (ES) cell lines derived from the inner cell mass of blastocysts remain pluripotent and can be stably propagated indefinitely when cultured in conditions that suppress their differentiation [14]. Despite extended periods in culture, they retain the capacity to differentiate into all fetal and adult cell types, a characteristic best demonstrated by the ability of mouse ES (mES) cells to reintegrate into host blastocysts and contribute to somatic and germ line tissues in chimeras [1, 2]. Current knowledge of the mechanisms that regulate ES cell self-renewal and differentiation is based largely on the study of mES cells [5, 6]. However, the derivation of pluripotent stem cell lines from human blastocysts has enabled investigations to be extended to another species [3, 4].

Maintenance of ES cell pluripotency requires the constant suppression of differentiation by both extrinsic and intrinsic factors [5]. The POU-domain transcription factor Oct-4 is highly expressed in ES cells [3, 4, 7] and has been shown to be essential for maintaining pluripotency in mES cells [8]. In an elegant series of experiments, in which Oct-4 expression was controlled by a tetracycline-regulated transgene, Niwa and colleagues showed that self-renewal was exquisitely dependent on the level of Oct-4 [8]. Whereas a twofold increase in Oct-4 promoted differentiation into embryonic and extraembryonic cell types typically produced upon withdrawal of the cytokine leukemia inhibitory factor (LIF), a reduction in the level of Oct-4 induced dedifferentiation into trophoblast, an extraembryonic lineage that mES cells do not normally generate [9]. This observation led to the proposal that at least one of the functions of Oct-4 is to operate as a gatekeeper to prevent respecification and dedifferentiation into extraembryonic ectoderm [8].

Establishment and maintenance of pluripotency in stem cells is a central issue in stem cell biology. In order to compare the role of Oct-4 in mouse and human ES cells, we employed RNA interference (RNAi) to knock down the transcription factor in both types of ES cells [10]. A particularly attractive feature of RNAi is that we could directly compare the effects of Oct-4 downregulation in multiple lines of both mouse and human ES cells. Although RNAi cannot completely eliminate Oct-4 function, we reasoned that, if a threshold level of Oct-4 is required for self-renewal, a relatively modest knockdown would allow us to compare Oct-4 functions in ES cells from both species.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Cell Culture   Human ES (hES) cells (H1 and H9) and mES cells (HM1, I114, D027, E14Tg2A, and ZHBTc4) were maintained as described previously [11, 12]. hES cells were passaged using phosphate-buffered saline (PBS)/0.5 mM EDTA, and ~1 x 105 cells were seeded onto matrigel-coated 6-well plates 24 hours prior to transfection. mES cells (1–5 x 104) were trypsinized and plated on gelatin-coated 6-well plates 24 hours before transfection. For immunofluorescence studies, ~2.0 x 104 hES and mES cells were seeded onto matrigel- or gelatin-coated chamber slides (Lab Tek 138121; Christchurch, New Zealand; http://www.vortexer.com) 24 hours and 48 hours, respectively, prior to transfection. Cell morphology was recorded using a Nikon microphot SA microscope and camera (TE2000U).

Small Interfering RNAs and Transfection
Small interfering (si)RNAs were obtained from Dharmacon Research, Inc. (Lafayette, CO; http://www.dharmacon.com). The annealed duplexes were prepared as recommended by the manufacturer. The sense strands of the synthetic oligonucleotide duplexes were: enhanced green fluorescent protein (EGFP): AAGAACGGCAUCAA GGUGAAC; mOct-4: AAGGAUGUGGUUCGAGUAUGG; and hOct-4: AAGGAUGUGGUCCGAGUGUGG.

ES cells were transfected with 80 nM (2 µg) of the siRNA duplex with Lipofectamine 2000 at a ratio of 1:2. Transfection complexes were prepared in Optimem (Invitrogen; Carlsbad, CA; http://www.invitrogen.com), and cells were transfected for 6 hours (hES) or 8–16 hours (mES) in ES growth medium or modified N2B27 medium [13]. After recovery in fresh cell culture medium, cells were transfected again at 24 hours. In luciferase reporter experiments, 1–2 x 105 hES and mES cells were seeded 24 hours prior to siRNA/plasmid cotransfections. Cells were incubated overnight with Lipofectamine 2000 complexes containing 0.5 µg fibroblast growth factor (FGF)4 enhancer-luciferase reporter plasmid (FGF4enh5') [14], 0.05 µg elongation factor (EF)1{alpha}-Renilla control plasmid [15], and siRNA duplexes to a final concentration of 80 nM. Cell lysates were prepared 24 hours posttransfection, and luciferase activity was assayed using Dual-Luciferase reporter reagents (Promega; Madison, WI; http://www.promega.com) and read with a Berthold LB96V luminometer (Bad Wildbad, Germany; http://www.bertholdtech.com). Assays were performed in triplicate, and luciferase activities were normalized relative to a cotransfected EF1{alpha}-Renilla control plasmid [15].

Immunoblotting
Embryonic stem cells were lysed and sonicated in SDS sample buffer. Lysates were electrophoresed on 10% SDS-PAGE gels and immunoblotted as described previously [12]. The primary antibodies against SHP-2 (sc-280) and Oct-4 (sc-5279) were supplied by Santa Cruz Biotechnology (Heidelberg, Germany; http://www.scbt.com) and used at a dilution of 1:1,000. Secondary horseradish peroxidase-conjugated antibodies (Amersham; Buckinghamshire, England; http://www.apbiotech.com) were used at a dilution of 1:5,000, and antigen complexes were detected using the ECL reagent (Amersham).

Immunostaining and Fluorescence Microscopy
Cells were fixed with 4% paraformaldehyde/PBS for 10 minutes, washed twice in PBS, and permeabilized for 2 minutes with 100% ethanol. The samples were then washed three times with PBS and blocked in PBS containing 10% goat serum for 1 hour. The primary antibodies were supplied by Santa Cruz Biotechnology, and concentrations used were Oct-4 (sc-5279) 1:200 and Gata6 (sc-9055) 1:100. Antibody/ antigen complexes were detected using antimouse fluorescein isothiocyanate-conjugated (715-093-150) or antirabbit Texas Red-conjugated (711-295-152) antibodies from Jackson ImmunoResearch (West Grove, PA; http://www.jacksonimmuno.com) at a dilution of 1:400 and visualized using a Nikon microphot SA microscope, camera, and Digital Pixel software. Three fields of view (total >100 cells) were counted to obtain quantitative data on Oct-4 knockdown and Gata6 induction.

X-Gal Staining and ONPG Assay
ß-galactosidase activity was monitored in situ by X-gal staining or quantitated biochemically using the o-nitrophenyl-D galactoside (ONPG) assay [12]. ß-galactosidase activity (optical density at 414 nM) was normalized with respect to protein concentration as determined using the BCA assay (Perbio 23223; Helsingborg, Sweden; http://www.perbio.com). Duplicate assays were performed on triplicate samples for each treatment. The absorbances of ONPG assays from D027 and I114 cells were read after 10-minute incubations at 37°C or overnight incubations at room temperature, respectively. Specific absorbance above background was obtained by subtracting readings obtained using parallel cultures from control (HM1) cells that lack a ß-galactosidase reporter.

Reverse Transcription-Polymerase Chain Reaction
RNA was prepared using the RNA-Bee reagent (AMS Biotechnology; Abingdon, UK; http://www.immunok.com) following the manufacturer’s instructions. Two micrograms of total RNA were reversed transcribed using 0.2 µg oligo-dT and 20 units of Moloney murine leukemia virus reverse transcriptase (Roche 1 062 603; Basel, Switzerland; http://www.roche.com) in a 20-µl reaction. Either one-tenth (hES) or one- twentieth (mES) of the reverse transcription reaction was used as a template for the polymerase chain reaction (PCR) reactions using Amplitaq Gold polymerase (Perkin Elmer; Boston, MA; http://instruments.perkinelmer.com). PCR products were fractionated on 1.5% Tris/Borate/EDTA (TBE) agarose gels and visualized under UV light using ethidium bromide. For a full list of primers and conditions used see Table 1Go and Table 2Go.


View this table:
[in this window]
[in a new window]
 
Table 1. Human primers used in RT-PCR studies
 

View this table:
[in this window]
[in a new window]
 
Table 2. Mouse primers used in RT-PCR studies
 

    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RNAi-Mediated Oct-4 Knockdown in mES and hES Cells
To examine Oct-4 knockdown in ES cells, we transfected mouse and hES cells with Oct-4-specific siRNAs. The oligonucleotides were designed in accordance with Tuschl Lab guidelines [10] and derived from an orthologous region in mouse and human Oct-4 mRNAs differing in two nucleotides. Transfection with an EGFP-specific siRNA served as a negative control. Preliminary experiments performed in mES cells established that, 20 hours after transfection with the Oct-4-specific siRNA oligonucleotide, the level of Oct-4 was lower by more than 80% compared with EGFP siRNA-transfected controls (data not shown). However, due to an appreciable recovery of Oct-4 expression by 48 hours, we routinely employed a second transfection at 24 hours to ensure continuous inhibition over the 48-hour time course. Whereas transfection with species-specific siRNAs dramatically reduced the level of Oct-4 protein in mES and hES cells, cross-species oligonucleotides only exhibited a slightly lower level compared with control EGFP siRNA (Fig. 1AGo). Immunohistochemistry confirmed this selective knockdown of Oct-4 at the cellular level (Fig. 1BGo and 1CGo). Oct-4 protein was detected in >90% of the nuclei of mES and hES cells transfected with EGFP or the cross-species Oct-4 siRNA, compared with 30%-35% of mES and hES cells treated with the species-specific siRNA (Fig. 1DGo). Concomitant with the decrease in Oct-4 protein, we also observed a decrease in Oct-4-dependent transcription, as measured by activation of the Oct-4-regulated FGF4enh5' luciferase reporter gene [14]. Whereas cotransfection of the reporter with cross-species Oct-4 siRNAs produced negligible reduction in luciferase activity, the species-specific Oct-4 siRNAs dramatically reduced Oct-4-dependent transcription by 50%-65% within 24 hours (Fig. 1EGo). The rapid knockdown and loss of Oct-4-dependent transcription demonstrated that our siRNAs could be used effectively to study Oct-4 function in both mES and hES cells.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 1. RNAi-mediated Oct-4 inhibition in mES and hES cells. A) Western blot analysis of Oct-4 protein levels in ES cells following siRNA transfection. Cell lysates from HM1 and H9 cells were prepared 48 hours after transfection with EGFP (E), mouse Oct-4 (m), or human Oct-4 (h) siRNAs and fractionated by SDS-PAGE, immunoblotted, and probed with Oct-4 and SHP2 (control) antibodies. B and C) Oct-4 protein expression in siRNA-transfected ES cells. HM1 (B) and H9 (C) cells were transfected for 48 hours, fixed, immunostained with a monoclonal antibody specific for Oct-4, and counterstained for DNA with DAPI. D) Quantitation of Oct-4 expression in situ. Oct-4-positive nuclei were counted in three fields of view (each >100 cells) for transfections in B and C. E) Inhibition of Oct-4-dependent transcription in siRNA-transfected ES cells. D027 mES and H9 hES cells were transfected with siRNA, EF1{alpha} Renilla control and the FGF4enh5'-dependent luciferase reporter plasmid. Transfections were performed in triplicate, and luciferase activities were normalized relative to the cotransfected EF1{alpha}-Renilla control. Values represent means ± SE. Results of a representative transfection are shown.

 
Oct-4 Knockdown Induces Rapid Differentiation in mES Cells
To establish whether Oct-4 knockdown induced differentiation in mES cells, we transfected two ES cell lines carrying wild-type Oct-4 alleles: an E14Tg2A (E14-IA3) cell line that contributes efficiently to the coat color and germ line of chimeric animals and is, therefore, pluripotent (data not shown), and an HM1 subclone [16]. E14-IA3 cells were transfected with either Oct-4 or EGFP siRNA in the presence of LIF or cultured in the absence of the cytokine, and their responses were analyzed over 72 hours. Whereas EGFP siRNA-transfected colonies remained largely undifferentiated for up to 62 hours, withdrawal of LIF produced ES cell mixed colonies containing morphologically differentiated cell types and residual stem cells. In contrast, cells transfected with mOct-4 siRNA began to flatten at 24 hours, and by 48 hours, the majority of colonies were composed of overtly differentiated cells (Fig. 2AGo). These cells continued to proliferate rapidly, and by 62 hours they had spread out to form a monolayer comprising cells that were morphologically similar to a subset formed during LIF withdrawal or background differentiation (Fig. 2AGo, compare inset panels). At the molecular level, Oct-4 knockdown in E14-IA3 cells correlated with the upregulation of a trophoblast stem cell marker, Cdx2 [17], in line with previously reported results [8]. In addition, however, we also observed increased expression of the endoderm-associated genes Gata6 and {alpha}-fetoprotein (AFP). Negligible induction of FGF5, (a primitive ectoderm marker), Brachyury (mesoderm), or Pax6 (embryonic ectoderm, data not shown) was observed on Oct-4 knockdown. Expression of placental lactogen (PL-1), a marker of differentiated trophoblast, was below the level of detection in E14-IA3 cells. FGF5 and Brachyury (T) were upregulated when cells were cultured in the absence of LIF, confirming that E14-IA3 cells differentiated appropriately in our culture conditions (Fig. 2BGo). Oct-4 knockdown in the HM1 cell line induced a pattern of morphological and molecular differentiation similar to that observed with E14-IA3 cells (Fig. 2CGo). Differentiated HM1 cells exhibited coordinate induction of Cdx2, Gata6, and AFP expression, but also no detectable upregulation of PL-1 transcription (Fig. 2DGo). Induction of Gata6 and AFP expression as well as the trophoblast-associated gene Cdx2 is, therefore, a consistent feature of Oct-4 knockdown in wild-type mES cells.



View larger version (115K):
[in this window]
[in a new window]
 
Figure 2. Oct-4 knockdown induces epithelial-like differentiation in mES cells. A) Morphology of an E14-IA3 mES cell line after transfection with siRNAs or withdrawal of LIF. E14-IA3 cells were seeded overnight in ES cell medium and then transfected with siRNA or switched to medium without LIF. Cell morphology was recorded at intervals during 62 hours after transfection. The higher magnification of differentiated cells (inset) shows the similar morphologies of cells following mOct-4 siRNA transfection and LIF withdrawal. The white arrow highlights cell morphology typical of undifferentiated mES cells. B) RT-PCR analysis of gene expression in E14-IA3 cells. cDNA was prepared from samples collected at 24, 48, and 72 hours posttransfection and amplified with primer pairs specific for the genes shown. Samples EB and PL correspond to control amplifications with day-10 embryoid body-and mouse placenta-derived cDNA, respectively. C) HM1 cells were seeded overnight in ES cell medium and then transfected with siRNAs. Cell morphology was recorded 48 hours posttransfection. D) RT-PCR analysis of gene expression in HM1 cells. cDNA was prepared from samples collected at 48 hours posttransfection and amplified with primer pairs specific for the genes shown.

 
Induction of an Endoderm-Specific ß-Galactosidase Gene-Trap Reporter
To explore further the possible association between Oct-4 knockdown and endoderm differentiation, we examined the response of a unique ß-galactosidase gene-trap reporter within the Gtar gene of the I114 cell line [18, 19] that is exclusively expressed in primitive embryonic liver endoderm and yolk sac in vivo and coexpressed with liver marker genes in vitro [19, 20]. We found that transfection of mOct-4 siRNA, in contrast to control siRNAs, produced a markedly (~ninefold) greater level of ß-galactosidase expression in I114 cells (Fig. 3AGo). X-gal staining of transfected cultures revealed that ß-galactosidase-positive cells were first evident 3 days after transfection, and their number increased until day 5, when they represented a small, but significant, minority of cells within the culture (Fig. 3BGo). To exclude the possibility that the I114 lacZ-positive cells might be generated indirectly from untransfected stem cells induced by paracrine signaling from differentiating neighbors, we cocultured I114 cells with Oct-4 siRNA-transfected HM1 cells. ß-galactosidase activity was not induced in these cocultures, demonstrating that induction of the Gtar gene-trap reporter by Oct-4 knockdown in I114 cells was cell autonomous (data not shown).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 3. Induction of an endoderm-specific ß-galactosidase gene trap reporter. A) Biochemical analysis of gene-trap reporter activity in siRNA-transfected ES cells. I114 cells were transfected with siRNAs or grown in the absence of LIF. Five days after transfection, ß-galactosidase activity was measured by ONPG assay and normalized against the protein concentration in cell lysates. Values are the mean of triplicate transfections ± SE. B) Morphology of cells that expressed the gene-trap reporter following Oct-4 knockdown. I114 cells transfected with mouse Oct-4 siRNA were cultured for 5 days, fixed, and stained for ß-galactosidase activity with X-gal. A representative field of view containing X-gal-positive cells is shown.

 
Oct-4 Knockdown Parallels Conditional Suppression of the Oct-4 Transgene in the ZHBTc4 mES Cell Line
To confirm that induction of the endoderm-associated genes by RNAi was due to suppression of Oct-4, we compared siRNA-mediated knockdown with inactivation of Oct-4 expression in the ZHBTc4 cell line [8]. In this cell line, both endogenous alleles are mutated, and Oct-4 expression is maintained by a tetracycline-regulated Oct-4 transgene at 60% of the level in wild-type ES cells [8]. After 24 hours of transfection with mOct-4 siRNA, cells formed small compact colonies that by 48 hours began to flatten out into coherent groups of differentiated epithelial-like cells (Fig. 4AGo). This paralleled the changes in ES cell morphology induced by treating ZHBTc4 cells with doxycycline and was similar to the pattern described previously for inactivation of the Oct-4 transgene [8]. In contrast, ZHBTc4 cells transfected with EGFP siRNA remained morphologically undifferentiated and were indistinguishable from control cells. RT-PCR analysis confirmed that expression of Oct-4 was significantly reduced by Oct-4 siRNA transfection and completely eliminated by doxycycline treatment. Despite the different methods used to downregulate Oct-4, expression of the trophoblast stem cell-associated transcription factor Cdx2 was induced similarly by both treatments. In contrast to the other mES cells tested, we also detected induction of the trophoblast differentiation marker PL-1 (Fig. 4BGo). Upregulation of Gata6 and AFP in both doxycycline-treated and Oct-4 siRNA-transfected cells, however, confirmed that increased expression of these endoderm-associated genes in mES cells was induced by downregulation of Oct-4.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 4. Oct-4 knockdown in the ZHBTc4 mES cell line. A) Morphology of ZHBTc colonies 48 hours post-siRNA transfection or posttreatment with doxycycline (200 ng/ml). Both mOct-4 siRNA- and doxycycline-treated ZHBTc4 cultures contained smaller coherent colonies that often contained areas with amorphous tightly packed cells. B) Expression of endoderm and trophoblast genes in ZHBTc4 cells. PCR analysis was performed on cDNA prepared from cell cultures collected 48 hours posttransfection with siRNAs or 48 hours postinduction with doxycycline (dx) or untreated cell cultures (–).

 
Oct-4 Knockdown Induces Differentiation of hES Cells
To examine the requirement for Oct-4 in human ES cells, we transfected two independently derived lines of ES cells, H1 and H9, under feeder-free conditions routinely used for long-term propagation of undifferentiated hES cells [11]. Transfection with hOct-4 siRNA produced diffuse colonies of cells with a flattened, squat morphology, indicative of differentiation (Fig. 5AGo). In contrast, cells transfected with either EGFP or mouse-specific Oct-4 siRNA formed dense overgrowing colonies typical of undifferentiated hES cell cultures. Analysis of gene expression by RT-PCR confirmed the selective downregulation of Oct-4 in hOct-4 siRNA-transfected cells (Fig. 5BGo). A slight but reproducible decrease in expression of telomerase catalytic subunit with reverse transcriptase activity (Tert) was observed upon Oct-4 knockdown, consistent with the differentiation of stem cells. Interestingly, there was a marked increase in the level of Gata6 and Gata4 transcripts upon Oct-4 knockdown. The increase in Gata6 expression was confirmed at the cellular level by immunofluorescence (Fig. 5CGo). In contrast to Oct-4 knockdown in mES cell transfections, however, increased expression of AFP expression was not detected. Moreover, with the exception of Gata3, little induction was observed for either early (Gata2, Cdx2) or late (chorionic gonadatropin [CG]{alpha}, CGß, PL-1) markers of trophoblast differentiation. Since Gata6 precedes AFP expression in some endoderm cell types, we considered the possibilities that these Oct-4-depleted hES cultures might contain immature endodermal precursors or that the particular culture conditions might restrict the differentiation of ES cell derivatives. We, therefore, accelerated the maturation of differentiated cells by transfecting cells cultured in a modified N2B27 medium [13] that lacks serum supplements, fibroblast-conditioned medium, or FGF2. In this medium, the majority of hES cells transfected with hOct-4 siRNA had clearly differentiated by 96 hours, in comparison with the mOct-4 siRNA control cultures (Fig. 5DGo). The morphology of these differentiated cells was strikingly similar to the epithelial-like cells produced by Oct-4 knockdown in mouse ES cells. Moreover, RT-PCR analysis showed a dramatic induction of AFP as well as Gata6, paralleling the pattern of endoderm marker gene expression observed in mouse ES cells. Interestingly, increased expression of CG{alpha} and Cdx2 was also detected in these cultures, consistent with the induction of trophoblast differentiation.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 5. Oct-4 knockdown induces differentiation of hES cells. A) Morphology of H9 and H1 hES cells 48 hours after siRNA transfection. H9 and H1 cells maintained in medium supplemented with mouse embryonic fibroblast-conditioned medium (MEF-CM) and basic FGF were transfected with EGFP, mOct-4, and hOct-4 siRNAs. Images of representative colonies were recorded approximately 48 hours post-transfection. The white arrows highlight examples of flattened cell morphology typical of differentiated hES cells. B) PCR analysis was performed on cDNA prepared from cell cultures (maintained in MEF-CM) 48 hours posttransfection, and cDNA prepared from day 6 H9 EB served as a positive control. C) Immunohistochemical detection of Gata6 protein in siRNA-transfected H9 hES cells. H9 cultures were fixed 48 hours after siRNA transfection, permeabilized, and incubated with Gata6 polyclonal antibody. Immobilized antigen/antibody complexes were detected using an antirabbit TR-conjugated secondary antibody. Quantitation of Gata6-positive nuclei in three fields of view (total >100 cells) revealed at least a fivefold greater level of Gata6-expressing cells in hOct-4 siRNA-transfected cells (28%) compared with EGFP siRNA (5%) controls. D) Morphology of H9 hES cells after Oct-4 knockdown in N2B27 medium. After seeding cells overnight in standard hES cell culture conditions, the medium was changed to N2B27, and cells were transfected with hOct-4 or mOct-4 siRNAs. The morphology of representative colonies was recorded 96 hours after starting transfections. E) RT-PCR analysis of differentiation markers in H9 cells cultured in N2B27 medium. cDNA prepared from cells treated as described in (D) was analyzed for induction of endoderm and trophoblast marker expression by PCR. EB cDNA was prepared from day-6 H9 EBs.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The transcription factor Oct-4 operates as a gatekeeper of stem cell pluripotency in mES cells [8]. Suppression of Oct-4 below a threshold level of approximately 50%, via conditional inactivation of an Oct-4 transgene in the ZHBTc4 cell line, triggered dedifferentiation of these cells into the trophoblast lineage. In the report presented here, we used RNAi-mediated gene knockdown to extend the analysis of Oct-4 function to multiple lines of both human and mouse ES cells. We found that, in ES cells of both species, Oct-4 knockdown led to a decrease in stem identity and increased differentiation at the morphological and molecular level. This demonstrates that Oct-4 is essential for hES cell self-renewal and establishes a conserved role for the factor in maintaining pluripotency in mammals.

RNAi-mediated depletion of Oct-4 in mES cells induced expression of the trophoblast stem cell marker Cdx2 [17] and the appearance of flattened epithelial-like cells, some of which exhibited morphology typical of differentiated trophoblast giant cells. This paralleled the response triggered by conditional inactivation of the Oct-4 transgene in the ZHBTc4 cell line and confirmed that induction of trophoblast differentiation is a general feature of downregulation of Oct-4 in mES cells. Moreover, this establishes that RNAi-mediated knockdown is an effective tool for investigating Oct-4 function in ES cells, a finding supported by the recent demonstration that an Oct-4-specific short hairpin RNA can induce trophoblast marker expression in mES cells [21].

Oct-4 knockdown in hES cells also produced epithelial-like differentiation, but, compared with mES cells, the cultures exhibited a restricted induction of the trophoblast markers. Under growth conditions that support long-term self-renewal of hES cells, expression of Cdx2 was not induced. Furthermore, although Cdx2 and hCG{alpha} were detected when Oct-4 depletion was performed in conditions suboptimal for self-renewal, the trophoblast differentiation marker PL-1 was not induced despite its basal expression in control hES cell cultures. This surprising result suggests that PL-1 expression may depend on stem-cell-derived signals and, in differentiated human cells, it might require an extended period of culture. The difference between the immediate responses of mouse and human ES cells could simply have arisen from the specific growth media used to culture the two cell types and stimulation via distinct extracellular factors. Alternatively, it could reflect intrinsic differences between mouse and human ES cells in their responses to downregulation of Oct-4.

However, a novel and consistent feature of Oct-4 knockdown in both human and mouse ES cells was the upregulation of genes typically associated with endoderm differentiation. In mES cells, Gata6, AFP, and the liver/yolk sac-specific Gtar gene trap were induced following Oct-4 knockdown. Increased Gata6 expression was also observed in doxycycline-treated ZHBTc4 cells, confirming that this was due to suppression of Oct-4. Indeed, induction of Gata6 and other endoderm-associated markers, such as BMP2, were recently reported in a more comprehensive analysis of endoderm markers in Oct-4-depleted ZHBTc4 cells [22]. In hES cells, Oct-4 depletion led to induction of Gata6 at both the mRNA and protein levels. This occurred under conditions when Cdx2 was not detected, indicating that Gata6 expression is likely to be an immediate response to downregulation of Oct-4 in hES cells.

The significance of the induction of endoderm-associated genes upon Oct-4 depletion is unclear at present. It could point to the differentiation of both trophoblast and endoderm cell types upon Oct-4 knockdown. This would be consistent with a degree of heterogeneity in the morphology of cells present in the cultures, heterogenous staining for Gata6 in hES cells, and expression of the Gtar gene-trap marker in only a subset of the differentiated mES cells. However, these differences could also arise from asynchronous differentiation along one basic pathway. Gata6 expression is not generally considered to be associated with trophoblast differentiation, but transient activation of a Gata6-dependent ß-galactosidase transgene has been reported within trophoblast cells in mouse blastocysts [23]. Expression of endogenous Gata6 transcripts, however, could not be confirmed by in situ hybridization, indicating that either the level of expression was very low or the ß-galactosidase activity might be carried over from Gata6 promoter activity within a progenitor cell. Indeed, immediately after implantation, activity of the Gata6/ß-galactosidase transgene became restricted to a discrete subset of cells within the inner mass cells adjacent to the trophoblast and primitive endoderm [23]. Induction of Gata6 in both mouse and human ES cells upon Oct-4 knockdown may therefore point to a common origin between trophoblast and an endodermal lineage. In fact, Cdx2 expression within the chorioallantoic placenta and hindgut endoderm links these structurally related tissues [17]. A broader function for Oct-4 in regulating differentiation is suggested by persistence of Oct-4 within the primitive ectoderm until gastrulation [7] and a possible role in neurogenesis [24]. Moreover, the identification of Oct-4-related molecules in vertebrates other than mammals [25, 26] is consistent with a role in regulating pluripotency of embryonic cells more generally, with the induction of Gata6 in both mouse and human ES cells, perhaps reflecting this conserved role.


    ACKNOWLEDGMENT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This work was supported by the Biotechnology and Biological Sciences Research Council (T.B., L.S., J.C.) and the Geron Corporation (D.C.H., J.C.). We are grateful to Melany Jackson for advice on RT-PCR and providing control RNA and primers, Virginie Sottile for control hES RNA, Kinchi Nakashima for EF1{alpha}-Renilla plasmid, Hitoshi Niwa for FGF4enh5' plasmid, Austin Smith for ZHBTc4 cells, Lesley Forrester for I114 cells, and Lesley Gerrard for HM1 and H9 sublines. We also thank Michael Clinton, Joseph Mee, and Joshua Brickman for critical comments during development of the manuscript. This work is dedicated to the memory of Dr. Michael Burdon.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Evans MJ, Kaufman M. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981;292:154–156.[CrossRef][Medline]

  2. Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci USA 1981;78:7634–7638.[Abstract/Free Full Text]

  3. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  4. Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000;18:399–404.[CrossRef][Medline]

  5. Smith AG. Embryo-derived stem cells: of mice and men. Annu Rev Cell Dev Biol 2001;17:435–462.[CrossRef][Medline]

  6. Burdon T, Smith A, Savatier P. Signalling, cell cycle and pluripotency in embryonic stem cells. Trends Cell Biol 2002;12:432–438.[CrossRef][Medline]

  7. Pesce M, Gross MK, Scholer HR. In line with our ancestors: Oct-4 and the mammalian germ. Bioessays 1998;20:722–732.[CrossRef][Medline]

  8. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000;24:372–376.[CrossRef][Medline]

  9. Beddington RSP, Robertson EJ. An assessment of the developmental potential of embryonic stem cells in the midgestation mouse embryo. Development 1989;105:733–737.[Abstract/Free Full Text]

  10. Elbashir SM, Harborth J, Lendeckel W et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001;411:494–498.[CrossRef][Medline]

  11. Xu C, Inokuma MS, Denham J et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol 2001;19:971–974.[CrossRef][Medline]

  12. Burdon T, Stracey C, Chambers I et al. Suppression of SHP-2 and ERK signaling promotes self-renewal of mouse embryonic stem cells. Dev Biol 1999;210:30–43.[CrossRef][Medline]

  13. Ying QL, Stavridis M, Griffiths D et al. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol 2003;21:183–186.[CrossRef][Medline]

  14. Niwa H, Masui S, Chambers I et al. Phenotypic complementation establishes requirements for specific POU domain and generic transactivation function of Oct-3/4 in embryonic stem cells. Mol Cell Biol 2002;22:1526–1536.[Abstract/Free Full Text]

  15. Nakashima K, Yanagisawa M, Arakawa H et al. Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science 1999;284:479–482.[Abstract/Free Full Text]

  16. Magin TM, McWhir J, Melton DW. A new mouse embryonic stem cell line with good germ line contribution and gene targeting frequency. Nucleic Acids Res 1992;20:3795–3796.[Free Full Text]

  17. Beck F, Erler T, Russell A et al. Expression of Cdx-2 in the mouse embryo and placenta: possible role in patterning of the extra-embryonic membranes. Dev Dyn 1995;204:219–227.[Medline]

  18. Forrester LM, Nagy A, Sam M et al. An induction gene trap screen in embryonic stem cells: identification of genes that respond to retinoic acid in vitro. Proc Natl Acad Sci USA 1996;93:1677–1682.[Abstract/Free Full Text]

  19. Watt AJ, Jones EA, Ure JM et al. A gene trap integration provides an early in situ marker for hepatic specification of the foregut endoderm. Mech Dev 2001;100:205–215.[CrossRef][Medline]

  20. Jones EA, Tosh D, Wilson DI et al. Hepatic differentiation of murine embryonic stem cells. Exp Cell Res 2002;272:15–22.[CrossRef][Medline]

  21. Velkey JM, O’Shea KS. Oct-4 RNA interference induces trophectoderm differentiation in mouse embryonic stem cells. Genesis 2003;37:18–24.[CrossRef][Medline]

  22. Mitsui K, Tokuzawa Y, Itoh H et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003;113:631–642.[CrossRef][Medline]

  23. Koutsourakis M, Langeveld A, Patient R et al. The transcription factor GATA6 is essential for early extraembryonic development. Development 1999;126:723–732.[Abstract]

  24. Shimozaki K, Nakashima K, Niwa H et al. Involvement of Oct3/4 in the enhancement of neuronal differentiation of ES cells in neurogenesis-inducing cultures. Development 2003;130:2505–2512.[Abstract/Free Full Text]

  25. Hinkley CS, Martin JF, Leibham D et al. Sequential expression of multiple POU proteins during amphibian early development. Mol Cell Biol 1992;12:638–649.[Abstract/Free Full Text]

  26. Whitfield T, Heasman J, Wylie C. XLPOU-60, a Xenopus POU-domain mRNA, is oocyte-specific from very early stages of oogenesis, and localised to presumptive mesoderm and ectoderm in the blastula. Dev Biol 1993;155:361–370.[CrossRef][Medline]

Received September 26, 2003; accepted for publication October 30, 2003.



This article has been cited by other articles:


Home page
Hum ReprodHome page
G. Cauffman, M. De Rycke, K. Sermon, I. Liebaers, and H. Van de Velde
Markers that define stemness in ESC are unable to identify the totipotent cells in human preimplantation embryos
Hum. Reprod., January 1, 2009; 24(1): 63 - 70.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. M. Toriello, E. S. Douglas, N. Thaitrong, S. C. Hsiao, M. B. Francis, C. R. Bertozzi, and R. A. Mathies
Integrated microfluidic bioprocessor for single-cell gene expression analysis
PNAS, December 23, 2008; 105(51): 20173 - 20178.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
M. F. Gjerstorff, L. Harkness, M. Kassem, U. Frandsen, O. Nielsen, M. Lutterodt, K. Mollgard, and H. J. Ditzel
Distinct GAGE and MAGE-A expression during early human development indicate specific roles in lineage differentiation
Hum. Reprod., October 1, 2008; 23(10): 2194 - 2201.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
X. Sun, X. Long, Y. Yin, Y. Jiang, X. Chen, W. Liu, W. Zhang, H. Du, S. Li, Y. Zheng, et al.
Similar biological characteristics of human embryonic stem cell lines with normal and abnormal karyotypes
Hum. Reprod., October 1, 2008; 23(10): 2185 - 2193.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. C. Hay, J. Fletcher, C. Payne, J. D. Terrace, R. C. J. Gallagher, J. Snoeys, J. R. Black, D. Wojtacha, K. Samuel, Z. Hannoun, et al.
Highly efficient differentiation of hESCs to functional hepatic endoderm requires ActivinA and Wnt3a signaling
PNAS, August 26, 2008; 105(34): 12301 - 12306.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
H. Fong, K. A. Hohenstein, and P. J. Donovan
Regulation of Self-Renewal and Pluripotency by Sox2 in Human Embryonic Stem Cells
Stem Cells, August 1, 2008; 26(8): 1931 - 1938.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Monk, M. Hitchins, and S. Hawes
Differential expression of the embryo/cancer gene ECSA(DPPA2), the cancer/testis gene BORIS and the pluripotency structural gene OCT4, in human preimplantation development
Mol. Hum. Reprod., June 1, 2008; 14(6): 347 - 355.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. A. Hohenstein, A. D. Pyle, J. Y. Chern, L. F. Lock, and P. J. Donovan
Nucleofection Mediates High-Efficiency Stable Gene Knockdown and Transgene Expression in Human Embryonic Stem Cells
Stem Cells, June 1, 2008; 26(6): 1436 - 1443.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. He, D. Pant, A. Schiffmacher, A. Meece, and C. L. Keefer
Lymphoid Enhancer Factor 1-Mediated Wnt Signaling Promotes the Initiation of Trophoblast Lineage Differentiation in Mouse Embryonic Stem Cells
Stem Cells, April 1, 2008; 26(4): 842 - 849.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
D. C. Hay, D. Zhao, J. Fletcher, Z. A. Hewitt, D. McLean, A. Urruticoechea-Uriguen, J. R. Black, C. Elcombe, J. A. Ross, R. Wolf, et al.
Efficient Differentiation of Hepatocytes from Human Embryonic Stem Cells Exhibiting Markers Recapitulating Liver Development In Vivo
Stem Cells, April 1, 2008; 26(4): 894 - 902.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. F. Cole, S. E. Johnstone, J. J. Newman, M. H. Kagey, and R. A. Young
Tcf3 is an integral component of the core regulatory circuitry of embryonic stem cells
Genes & Dev., March 15, 2008; 22(6): 746 - 755.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
L. Blomberg, K. Hashizume, and C. Viebahn
Blastocyst elongation, trophoblastic differentiation, and embryonic pattern formation
Reproduction, February 1, 2008; 135(2): 181 - 195.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Y. M.-S. Tay, W.-L. Tam, Y.-S. Ang, P. M. Gaughwin, H. Yang, W. Wang, R. Liu, J. George, H.-H. Ng, R. J. Perera, et al.
MicroRNA-134 Modulates the Differentiation of Mouse Embryonic Stem Cells, Where It Causes Post-Transcriptional Attenuation of Nanog and LRH1
Stem Cells, January 1, 2008; 26(1): 17 - 29.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
I. J. Groves and J. H. Sinclair
Knockdown of hDaxx in normally non-permissive undifferentiated cells does not permit human cytomegalovirus immediate-early gene expression
J. Gen. Virol., November 1, 2007; 88(11): 2935 - 2940.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
R. T. Rodriguez, J. M. Velkey, C. Lutzko, R. Seerke, D. B. Kohn, K. S. O'Shea, and M. T. Firpo
Manipulation of OCT4 Levels in Human Embryonic Stem Cells Results in Induction of Differential Cell Types
Experimental Biology and Medicine, November 1, 2007; 232(10): 1368 - 1380.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
F. Lavial, H. Acloque, F. Bertocchini, D. J. MacLeod, S. Boast, E. Bachelard, G. Montillet, S. Thenot, H. M. Sang, C. D. Stern, et al.
The Oct4 homologue PouV and Nanog regulate pluripotency in chicken embryonic stem cells
Development, October 1, 2007; 134(19): 3549 - 3563.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. Schenke-Layland, E. Angelis, K. E. Rhodes, S. Heydarkhan-Hagvall, H. K. Mikkola, and W. R. MacLellan
Collagen IV Induces Trophoectoderm Differentiation of Mouse Embryonic Stem Cells
Stem Cells, June 1, 2007; 25(6): 1529 - 1538.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Pasini, A. P. Bracken, J. B. Hansen, M. Capillo, and K. Helin
The Polycomb Group Protein Suz12 Is Required for Embryonic Stem Cell Differentiation
Mol. Cell. Biol., May 15, 2007; 27(10): 3769 - 3779.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Gassanov, M. Jankowski, B. Danalache, D. Wang, R. Grygorczyk, U. C. Hoppe, and J. Gutkowska
Arginine Vasopressin-mediated Cardiac Differentiation: INSIGHTS INTO THE ROLE OF ITS RECEPTORS AND NITRIC OXIDE SIGNALING
J. Biol. Chem., April 13, 2007; 282(15): 11255 - 11265.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Qin, T. Yu, T. Qing, Y. Liu, Y. Zhao, J. Cai, J. Li, Z. Song, X. Qu, P. Zhou, et al.
Regulation of Apoptosis and Differentiation by p53 in Human Embryonic Stem Cells
J. Biol. Chem., February 23, 2007; 282(8): 5842 - 5852.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Y. Babaie, R. Herwig, B. Greber, T. C. Brink, W. Wruck, D. Groth, H. Lehrach, T. Burdon, and J. Adjaye
Analysis of Oct4-Dependent Transcriptional Networks Regulating Self-Renewal and Pluripotency in Human Embryonic Stem Cells
Stem Cells, February 1, 2007; 25(2): 500 - 510.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
G. Cauffman, I. Liebaers, A. Van Steirteghem, and H. Van de Velde
POU5F1 Isoforms Show Different Expression Patterns in Human Embryonic Stem Cells and Preimplantation Embryos
Stem Cells, December 1, 2006; 24(12): 2685 - 2691.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. Hasegawa, T. Fujioka, Y. Nakamura, N. Nakatsuji, and H. Suemori
A Method for the Selection of Human Embryonic Stem Cell Sublines with High Replating Efficiency After Single-Cell Dissociation
Stem Cells, December 1, 2006; 24(12): 2649 - 2660.