| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
a
a University of Tübingen, Department of Internal Medicine II, Division of Hematology, Immunology, Oncology and Rheumatology, Tübingen, Germany;
b University Children’s Hospital, Department of Hematology/Oncology, Tübingen, Germany;
c Boehringer Ingelheim Austria, Department of Exploratory Research, Research and Development, Vienna, Austria;
d University of Tübingen, Department of Internal Medicine IV, Division of Diabetes Research, Tübingen, Germany
Key Words. Stem cell marker • Phenotype • CDCP1
Hans-Jörg Bühring, Ph.D., Medizinische Klinik II, Otfried-Müller-Str.10, 72076 Tübingen, Germany. Telephone: 49-7071-2982730; Fax: 49-7071-292730; e-mail: hans-joerg.buehring{at}med.uni-tuebingen.de
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the search for novel HSC markers we have recently identified CUB-domain-containing protein 1 (CDCP1) as a promising candidate molecule [7]. This molecule was originally identified as a novel epithelial tumor antigen by combining data derived from representational difference analysis and cDNA microarrays of lung cancer cell lines versus normal lung tissues [8]. CDCP1 mRNA was detected in colon and breast tumors and in the erythroleukemic cell line K562. The protein is a type I transmembrane protein that contains three CUB domains and several potential glycosylation sites within the extracellular domain. The cytoplasmic region contains a short hexalysine stretch and five potential tyrosine phosphorylation sites. CUB (complement protein subcomponents C1/1r, urchin embryonic growth factor, and bone morphogenetic protein 1) domains are structurally related to immunoglobulins and play important roles in cell adhesion [9]. Many proteins with such domains are developmentally regulated and have key functions in embryonic development [10–12]. These proteins include growth factors, proteases, activators of the complement system, and proteins involved in cell adhesion or interaction with extracellular matrix components [13].
We have recently demonstrated that transplantation of human CDCP1+ bone marrow (BM) cells into nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice gives rise to chimeric hematopoiesis [7]. Here we analyzed the reactivity of CDCP1-specific antibodies with normal and malignant hematopoietic cell populations and their influence in early hematopoiesis. In addition, we analyzed the CDCP1 expression on cells with mesenchymal stem cell (MSCs) and neural progenitor cell (NPC) phenotypes as well as on metastatic tissues from patients with colon and lung cancer.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MSCs, CD34+ BM cells, and NPCs were purchased from CellSystems (Remagen, Germany; http://www.biochrom.de). The following cell lines were purchased from the German Collection of Microorganisms and Cell Cultures (DSMZ), Braunschweig, Germany, and used for analysis of CDCP1 expression: K-562 (erythroleukemia), HEL (erythroleukemia), HL-60 (myeloid leukemia), KU-812 (basophil leukemia), BV-173 (B-lymphoblastic leukemia), Molt-4 (T-lymphoblastic leukemia), Weri-Rb-1 (retinoblastoma), and HepG2 (liver carcinoma). All cell lines were grown in RPMI 1640 culture medium (Invitrogen; Karlsruhe, Germany; http://www.invitrogen.com) supplemented with 10% fetal calf serum (FCS) and antibiotics. Cells were cultured at 37°C in 5% CO2.
Cell Processing
CD34+ cells of mPB were purified using the magnetic activated cell sorter (MACS) CD34 progenitor cell isolation kit (Miltenyi Biotech; Bergisch Gladbach, Germany; http://www.miltenyibiotec.com) according to the manufacturer’s guidelines. Enrichment of CDCP1+ cells was also performed by immunomagnetic separation. In this case, 1–2 x 108 BM cells were labeled with CDCP1-specific antibody CUB1 (IgG2b) and stained with phycoerythrin (PE)-conjugated isotype-matched goat anti-mouse antiserum (Caltag; San Francisco, CA; http://www.caltag.com). In the third step the cells were stained with anti-PE antibody conjugated to MACS beads. Separation of CDCP1+ cells was performed as described by the manufacturer (Miltenyi Biotech).
Cloning of the CDCP1 Expression Construct
Five micrograms of total RNA isolated from Colon 205 (ATCC, CCL 22) served as template in a reverse transcription reaction using Superscript II reverse transcriptase. The following primers designed from the sequence AY026461
[GenBank]
[8] were used for the preparation of polymerase chain reaction (PCR) fragments: forward primer (5'-GACT TCAGGCTAGCCCACACCATGGCCGGCCTGAACTG-3') and reverse primer (5'-GACTTCAGCTCGAGTTATTC TGCTGGCTCCATGGG-3'). PCR was performed on 1 µl of the resulting cDNA using JumpStart Red Accu Taq DNA Polymerase (Sigma; Dreisenhofen, Germany; http://www.sigmaaldrich.com). PCR cycling conditions were 96°C for 30 seconds, 35 cycles of 94°C for 15 seconds, 56°C for 3 minutes, and 68°C for 3 minutes followed by a final 68°C extension for 5 minutes. One microliter of the PCR fragment was subcloned in the TA vector (Stratagene; La Jolla, CA; http://www.stratagene.com) and released using the restriction enzyme SpeI/SalI and subsequently subcloned into the vector pBlueskript KS(+). For sequence comparison, three independent clones were picked and sequenced from both ends.
The intracellular domain of CDCP1 ranging from AA689 to AA836 flanked with a six-histidine-residue long tag (HIS tag) and a strep tag (VSSAWRHPQFGGGRGS) on the C-terminal region was PCR amplified using the primers 5'-GACTTCAGCTCGAGCCACCATGACAAAC AAGGGCCCC-3' and 5'-GACTTCAGACTAGTTTAAT GATGATGATGATATGAGAGCCTCTGCCGCCTCC GAACTGTGGATGCCTCCACGCTGAGGAGACTTCT GCTGGCTCCATG-3'. The resulting PCR fragment was digested with XhoI and SpeI and subcloned into the pFASTBAC vector (Invitrogen).
Cloning of CDCP1 cDNA Into a pRK Vector and Transfection of NIH-3T3 Cells
To monitor expression of CDCP1 in cells, a 5x myc tag epitope was added to the 3'-end of the open reading frame. PCR was performed on the parental plasmid pBS-CDCP1 with the primers 5'-CAAAGCTCATAAGAGCATCGG and 5'-GAGGATCCTTCTGCTGGCTCCATGGGCTC, introducing a BamHI site at the 3'-end and removing the stop codon. The PCR product was digested with BamHI and AccI and subsequently ligated into the cytomegalovirus immediate early promoter-based expression plasmid pRK together with an EcoRI-AccI fragment encoding the aminoterminal part of the protein. In the vector, the open reading frame was linked via the BamHI-site to a sequence encoding a 5x myc epitope. The expression plasmid was transfected at a 10:1 ratio together with the pSV2neo selection plasmid into NIH3T3 cells using the method of Chen and Okayama [14]. G418-resistant colonies were picked and expanded. An aliquot of the cells lysed in a Triton-X100 based lysis buffer was separated on an 8% SDS-polyacrylamide gel for size determination. The proteins were then transferred to a nitrocellulose filter and probed for the presence of CDCP1-myc using the anti-myc antibody 9E10. Cell clones overexpressing CDCP1 were then used for immunization.
Generation of a Polyclonal Antiserum Against the C-Terminal Region of CDCP1
To obtain specific antisera for protein expression analysis, the intracellular domain of CDCP1 (AA 689-836) was expressed in SF9 insect cells. The protein (18.48 kDa) was purified over a nickel column before immunization. Sera were either purified over the intracellular domain (CDCP1-Intra-E4I antibody) or over the peptide (AA 694-712) (CDCP1-Intra-E2P antibody). The titers of the eluted antibody were determined by enzyme-linked immunosorbent assay (data not shown). Fractions with best values were purified over sepharose columns, and protein concentrations of eluates were determined by Bradford assays.
Generation of Monoclonal Antibodies Against CDCP1
The general approach for the production of CDCP1-specific antibodies was previously outlined elsewhere [7]. The detailed procedure is described here: Antibodies against the extracellular domain of CDCP1 were generated by three serial immunizations of a BALB/c mouse (6 weeks) with 5–10 x 106 NIH-3T3 cells transfected with an expression plasmid containing the complete coding sequence of CDCP1 (NIH-3T3/huCDCP1). After the final boost the spleen cells were fused with SP2/0 myeloma cells. The resulting hybridoma cells were grown in RPMI 1640 culture medium (Invitrogen) containing 10% FCS (PAA; Linz, Austria; http://www.paa.at), 0.005% monothioglycerol (Sigma), 1% minimal essential medium amino acid solution (PAA), 100 U penicillin/streptomycin (Biochrom), and 1 x 10–4 M hypoxanthine, 4 x 10–7 M aminopterin, and 1.6 x 10–5 M thymidine (Sigma). Culture supernatants were screened by flow cytometric analysis on NIH-3T3/huCDCP1 cells, and positive hybridoma cell-secreting antibodies selectively recognizing the CDCP1 transfectant cell line, but not the parental NIH-3T3 cells, were cloned by limiting dilution. Four clones exclusively recognized NIH-3T3/huCDCP1 cells. These clones, termed CUB1-CUB4, were cultured in Integra CL1000 culture flasks (Integra Biosciences; Fernwald, Germany; http://www.integra-biosciences.com) and antibodies were purified from supernatants using Protein G Sepharose columns (Pharmacia Biotech; Freiburg, Germany; http://www.pnu.com). The isotypes of the antibodies were determined by flow cytometry analysis using PE-conjugated isotype-specific secondary antisera for staining (Southern Biotechnology; Birmingham, AL; http://www.southernbiotech.com).
Immunocytochemical Analysis
Surgically removed tissue specimens from colon and breast cancer patients and muscle tissues were used for immunohistochemical analysis with the antibody CDCP1-Intra-E4I [15]. Briefly, frozen sections (5 µm) were fixed in acetone and then incubated with the primary antibody (affinity-purified rabbit antibody CDCP1-Intra-E4I, 10 µg/ml) for 1 hour at room temperature. After washing, bound antibodies were detected using a biotinylated anti-rabbit IgG antibody in combination with the avidin-biotin-peroxidase complex system (DAKO; Glostrup, Denmark; http://www.dako.dk). For detection of unspecific staining, the primary antibody was substituted by rabbit IgG (10 µg/ml; DAKO) or phosphate buffered saline (PBS). Evaluation of the slides was performed using a Zeiss Axioskop light microscope. Photographs were taken using a Sony 3CCD video camera in combination with the Leica Q500W image analysis software.
Immunofluorescence Labeling and Flow Cytometry Analysis
Indirect Staining of Cells Growing cell lines or primary mononuclear cells from BM, PB, mPB, UCB, MSC, or NPC were washed in PBS supplemented with 0.1% bovine serum albumin (BSA) and 0.1% sodium azide (flourescence-activated cell sorter [FACS] buffer). In the next step cells were incubated with 20% human antibody serum for 10 minutes at 4°C to prevent unspecific binding of mouse antibodies. Cells were then incubated with 10 µg/ml of the primary antibody (CUB1 and CUB2) for 30 minutes on ice. After washing twice with FACS buffer, cells were stained with PE-conjugated goat anti-mouse IgG antiserum (Caltag) for 30 minutes at 4°C. Next, cells were rewashed twice, suspended in FACS buffer, and analyzed on a FACSCalibur flow cytometer (Becton Dickinson; Heidelberg, Germany; http://www.bd.com). Leukemic blasts from patients with AML, ALL, or CML-BC were additionally labeled with antibodies specific for CD34 (clone 43A1) [16] and CD133 (clone W6B3C1) [5].
Multicolor Staining of mPB, UCB, and BM Cells
Mononuclear PB, mPB, UCB, and BM cells of healthy donors or commercially available MSC and NPC were labeled with monoclonal antibody CUB1 (IgG2b), stained with PE-conjugated goat anti-mouse IgG2b-specific antiserum (Caltag), and with combinations of the following fluorochrome-conjugated antibodies: CD3-fluorescein isothiocyanate (FITC) (clone SK7), CD10-FITC (clone W8E7), CD14-FITC (clone M
P9), CD15-FITC (clone MMA), CD20-FITC (clone L27), CD34-FITC and CD34-PerCP (clone 8G12), CD38-FITC and CD38-APC (clone HB7), CD45-FITC (clone 2D1), CD56-FITC (clone NCAM 16.2), CD61-FITC (clone RUU-PL 7F12), CD71-FITC (clone L01.1) (all from Becton Dickinson), CD90-APC (clone 5E10) (PharMingen; San Diego, CA; http://www.bdbiosciences.com/pharmingen), CD235a-FITC (glycophorin A; clone 11E4B7.6) (Immunotech S.A.; Marseille, France; http://www.beckman.com), or with CD133-APC (clone AC133) (Miltenyi Biotec). After washing in FACS buffer the cells were analyzed on a FACSCalibur flow cytometer using the CellQuest software (Becton Dickinson). MACS-selected CDCP1+ cells were stained with CUB1 + anti-IgG2b-PE, CD38-FITC, CD34-PerCP, and CD133-APC. In selected cases, cells were isolated by flow cytometry using a FACSVantage cell sorter (Becton Dickinson).
Colony Assays
Ten thousand MACS-selected CD34+ BM cells were plated in 1 ml dishes (Greiner; Nürtingen, Germany) either without antibodies, or in the presence of a mixture of IgG2a and IgG2b control antibodies, or 30 µg/ml antibodies CUB1-CUB4. The cells were added to a ready-made medium (MethoCult GFH4434; CellSystems) containing 1% methylcellulose, 30% fetal bovine serum, 1% BSA, 10–4 M 2-mercaptoethanol, 2 mM L-glutamine, 50 ng/ml recombinant human (rh) stem cell factor, 10 ng/ml GM-CSF, 10 ng/ml interleukin-3, and 3 U/ml rh erythropoietin. After 14 days of incubation at 37°C in a humidified atmosphere (5% CO2), BFU-E, granulocyte/macrophage colony-forming units, and mixed colonies were scored. For blocking studies, the cells were preincubated with 60 µg/ml of antibodies CUB1, CUB2, CUB3, or CUB4 before plating them into dishes.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
).
|
). Using antibodies against CDCP1, CD34, CD38, and CD133, we could further demonstrate that CD34+CD38– BM cells coexpressed CDCP1 and CD133 (Fig. 2B). In contrast to CD34, CDCP1 was not expressed on cells expressing higher levels of the transferrin receptor CD71 and was only rarely found on CD10+ B-cell precursor cells (Fig. 2C). Since more mature erythroid progenitors are known to reside in the fraction expressing high levels of CD71 and B-lymphoid progenitors are CD10+, CDCP1 appears to spare immature erythroid and B-lymphoid precursor cell subsets.
|
). Figure 3C shows that more than 99% of the CDCP1+ cells were positive for CD34. Most of these cells also coexpressed CD133. The fact that only 81% of these cells appeared to be positive for CD133 reflects the insufficient resolution of the CD133-APC (compared with CD133-PE) conjugate rather than the real population size. In addition to the major population with moderate CDCP1 expression, a minor population was found that expressed very high levels of CDCP1 (Fig. 3D). Interestingly, this population was negative for both CD34 and CD133. More detailed analyses revealed that this population coexpressed CD45 and HLA-DR (not shown), indicating that these cells are of hematopoietic origin.
|
shows CDCP1 expression on 4 of 20 ALL, 7 of 11 AML, and 7 of 10 CML-BC samples. By contrast, CD133 was found on 7 of 20 ALL, 8 of 11 AML, and 4 of 10 CML-BC samples, and CD34 on 15 of 20 ALL, 7 of 11 AML, and 8 of 10 CML-BC samples. This suggests that CDCP1 and CD133 are expressed on leukemic blasts at similar but lower frequencies than CD34. A predominant CD34 expression was found in ALL samples, which is in line with the fact that CD34 detects a larger cell population of normal B-lymphoid precursors than CD133 or CDCP1.
|
50%; Table 1
). However, some samples were only double-positive for CDCP1 and CD34 or CDCP1 and CD133, and two of the studied samples exclusively expressed CDCP1. Hence, CDCP1 is a novel independent marker for the diagnosis of leukemia.
Influence of Antibodies CUB1-CUB4 on the Differentiation of CD34+ BM Cells
To study a potential regulatory effect of antibodies CUB1-CUB4 on the differentiation of CD34+ stem/progenitor cells, colony-forming assays were performed. CD34+ BM cells were grown in a commercial semisolid methylcellulose medium in the presence of defined growth factors (see Materials and Methods) and antibodies CUB1-CUB4 (60 µg/ml) or isotype-matched control antibodies. Fourteen days after culture, the colony numbers were determined.
Figure 4A shows that all CDCP1-reactive antibodies were able to moderately stimulate the growth of erythroid colonies (n = 2). Antibody CUB1 showed the most prominent effect on the growth of erythroid colonies (1.5–2-fold increase of colony-forming units erythroid [CFU-E]; p 
0.05) and was chosen to study the dose dependency of CFU-E growth. Figure 4B demonstrates a clear correlation between antibody concentration and colony growth. Other hematopoietic colony types were not affected (not shown). This suggests that CDCP1 may be involved in early steps of erythropoiesis.
|
, CDCP1 was moderately expressed on cells with both MSC and NPC phenotypes. This is in contrast to the nonreactivity of CD34 with MSCs and NPCs, and the negativity of CD133 for MSCs.
|
). Strong reactivity of CDCP1 antibodies with tumor cells was also seen in 15 of 16 breast cancer samples. Figure 6C shows a predominant staining of epithelial cells derived from a lobular mamma carcinoma. Control staining of colon (Fig. 6B) and mamma carcinoma cells (Fig. 6D) using a rabbit IgG antibody showed no reactivity. These data are in line with the observation that CDCP1 mRNA is overexpressed in colon and breast carcinoma [8].
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The selectivity of CDCP1 for HSC resembles more CD133 than CD34. Like CD133, CDCP1 spares many CD34+ cells that consist of immature CD10+ B-lymphoid cells as well as of CD34+ erythroid progenitor cell subsets with high transferrin receptor (CD71) levels. Moreover, the density of CDCP1 antigen expression on HSC is very similar to that of CD133 and lower than that of CD34. Interestingly, CDCP1 does not define exactly the same population as CD133 because it additionally recognizes a very rare CD34– population that is negative for CD133. The identity of this CD45+CD34–CD133– population remains to be elucidated.
Antibodies against stem cell antigens are indispensable tools for routine leukemia diagnosis. Traditionally, antibodies against CD34, CD117 (c-kit), CD133, and CD135 (FLT3) are used in combination with antibodies recognizing antigens on mature cells in order to identify and characterize the leukemic population. Of these markers, CD34, CD133, and CD135 are found on lymphoblastic and myeloblastic leukemias, whereas the expression of CD117 appears to be restricted to the myeloid lineage. Each of these molecules represents independent markers that are not necessarily correlated with the expression of any of the other markers. Not surprisingly, CDCP1 is a novel addition to the spectrum of independent markers for acute leukemias. Although most of the analyzed leukemic blasts that expressed CDCP1 were also positive for CD34 and/or CD133, 1 of 20 ALL and 1 of 10 CML-BC samples exclusively expressed CDCP1. Interestingly, these samples were also negative for CD117 and CD135. Therefore, the use of CDCP1 as an additional marker for leukemia diagnosis was of particular value in these cases. Whether CDCP1 or a potential malignant variant of this molecule plays a role in leukemic transformation, or whether CDCP1 expression is merely a concomitant feature of the various differentiation stages in many leukemic blasts, is not known.
CDCP1 protein is not only a marker for HSCs and their progenitors but apparently also for stem cells of other origins. Thus, CDCP1 was additionally found on cells expressing mesenchymal and neural stem/progenitor cell phenotypes, indicating that this unique surface molecule is expressed on a wider range of stem cells than CD34 (which is restricted to HSCs) or CD133 (which is additionally found on a subpopulation of NPC [17] but not on MSC). It is therefore intriguing to speculate that CDCP1 may be a general stem cell marker that is also expressed on multipotent adult progenitor cells (MAPC) [18, 19]. Our preliminary analyses on MAPC support this view.
Originally, CDCP1 was described as a novel marker for metastatic tissues overexpressed in colorectal cancer as well as in breast and lung carcinoma [8]. Normal colon tissues only weakly expressed CDCP1 [8]. Very recently, Hooper et al. found a strong SIMA135/CDCP1 protein expression on the surface of the highly metastatic hepatic cell line M+Hep3 [20]. This group designated the molecule SIMA135, according to an antibody that was raised against the subtractive immunization M+Hep3 associated 135 kDa protein [20]. In normal colon tissues, SIMA135/CDCP1 protein expression was restricted to the cell surface of epithelial cells, whereas cancerous colon tissues additionally expressed high levels of SIMA135/CDCP1 protein in the mucus of malignant glands [20]. Although the high expression of CDCP1 is not detected in all metastatic tissues [8, 20], we could show that CDCP1 protein is overexpressed in breast and colon cancer. Compared with the analyzed stem cell subsets, CDCP1 expression was much higher in these tumors. Hence, CDCP1 can be regarded primarily as a tumor marker that may be used to eliminate tumor cells, as described for Ep-CAM and MUC-1 [21–23]. However, the fact that CDCP1 is not only expressed on epithelial tumor cells, but also on stem cells, might be of clinical importance, because targeting of CDCP1 in BM or other tissues may not only result in the elimination of tumor cells but also adversely affect the survival of stem cells.
Little is known of the target molecules and physiologic function of CDCP1. Hooper et al. have demonstrated that the highly glycosylated molecule contains binding sites for SH2 and SH3 domains and is tyrosine phosphorylated by an Src kinase family member [20]. As CDCP1 has three CUB domains in the extracellular region, it is likely that the protein is involved in cellular interactions, because a variety of proteins with such domains are known to bind to cellular ligands. These molecules include a number of serine protein kinases, complement components, cubulin, spermadhesin, bone morphogenetic protein 1, and other proteins involved in cell adhesion or interaction with extracellular matrix components [24, 25]. To address the question of the existence of potential extracellular ligand, cell binding assays are currently employed [26] to analyze the binding of the extracellular domain of CDCP1 to a variety of cell lines. It is likely that cellular ligands are also expressed on the surface of hematopoietic cells because we have demonstrated that antibody CUB1 is able to enhance the formation of erythroid colonies. In fact, our preliminary observations indicate that a membrane-bound ligand of CDCP1 is expressed on the leukemic cell line Molm-1. This suggests that CDCP1 acts in an agonistic manner in erythropoietic differentiation by interacting with an as yet unidentified ligand. The identification of the cellular ligand is therefore of crucial importance to gain more insight into the molecular mechanisms of CDCP1 action.
Taken together, we have demonstrated that CDCP1 is not only a potent marker for a number of metastatic tumors such as colon and breast cancer, but also a novel stem cell antigen that is not only expressed on HSCs but also on NPCs and MSCs. Moreover, we provided evidence for a functional relevance of this molecule in early hematopoiesis. Future work will focus on the identification of cytoplasmic adapter molecules involved in the intracellular signaling cascade, and the characterization of the extracellular ligand. Finally, the feasibility of CDCP1 as a target molecule for the isolation of HSCs in clinical settings as well as for the elimination of metastatic tumor cells overexpressing CDCP1 needs to be evaluated in preclinical approaches.
|
ACKNOWLEDGMENT |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
FOOTNOTES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  T. Uekita, M. Tanaka, M. Takigahira, Y. Miyazawa, Y. Nakanishi, Y. Kanai, K. Yanagihara, and R. Sakai CUB-Domain-Containing Protein 1 Regulates Peritoneal Dissemination of Gastric Scirrhous Carcinoma Am. J. Pathol., June 1, 2008; 172(6): 1729 - 1739. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Siva, M. A. Wild, R. E. Kirkland, M. J. Nolan, B. Lin, T. Maruyama, F. Yantiri-Wernimont, S. Frederickson, K. S. Bowdish, and H. Xin Targeting CUB Domain-Containing Protein 1 with a Monoclonal Antibody Inhibits Metastasis in a Prostate Cancer Model Cancer Res., May 15, 2008; 68(10): 3759 - 3766. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Uekita, L. Jia, M. Narisawa-Saito, J. Yokota, T. Kiyono, and R. Sakai CUB Domain-Containing Protein 1 Is a Novel Regulator of Anoikis Resistance in Lung Adenocarcinoma Mol. Cell. Biol., November 1, 2007; 27(21): 7649 - 7660. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
