Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choi, Y.
Right arrow Articles by Lumelsky, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choi, Y.
Right arrow Articles by Lumelsky, N.

Stem Cells 2004;22:1070-1084 www.StemCells.com
© 2004 AlphaMed Press

Adult Pancreas Generates Multipotent Stem Cells and Pancreatic and Nonpancreatic Progeny

Yong Choi, Malancha Ta, Fouad Atouf, Nadya Lumelsky

National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland, USA

Key Words. Stem cells • Pancreatic islet • Differentiation • Multipotent stem cells • Diabetes

Correspondence: Nadya Lumelsky, Ph.D., Islet and Autoimmunity Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Building 10, CRC, Room 5-5940, 10 Center Drive, Bethesda, Maryland 20892-1453, USA. Telephone: 301-451-9834; Fax: 301-480-1269; e-mail: nadyal{at}intra.niddk.nih.gov


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 
Strategies designed to produce functional cells from stem cells or from mature cells hold great promise for treatment of different cell-degenerative diseases. Type 1 and type 2 diabetes are examples of such diseases. Although different in origin, both involve inadequate cell mass of insulin-producing ß cells, the most abundant cell type of pancreatic islets of Langerhans. Practical realization of such strategies is highly dependent on the elucidation of physiological mechanisms responsible for generation of new ß cells in the pancreas, which at this time are poorly defined. The in vitro differentiation systems allowing generation of new ß cells provide a valuable experimental tool for studying these mechanisms. Few such systems are currently available. In this work, we present an in vitro differentiation system, derived from adult mouse pancreas, capable of generating insulin-producing ß-like cells, which self-organize into islet-like cell clusters (ILCCs) during the course of the culture. Surprisingly, we found that along with the ILCCs, multiple cell types with phenotypic characteristics of embryonic central nervous system and neural crest are also generated. Moreover, several embryonic stem cell–specific genes are induced during the course of these cultures. These results suggest that the adult pancreas may contain cells competent to give rise to new endocrine and neural cells.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 
Insulin injections alleviate hyperglycemia in most patients with diabetes. However, they do not provide dynamic control of glucose homeostasis. Consequently, patients with long-term diabetes commonly develop life-threatening complications such as cardiovascular and kidney disease, neuropathy, and blindness. It has recently been shown that sustained independence from insulin injections can be achieved by transplantation of pancreatic islets into patients with diabetes [1]. Unfortunately, practical application of this clinical protocol is severely hampered by the shortage of islets available for transplantation. If functional ß-cells and islets could be generated ex vivo, present severe islet shortage could be overcome. Another possible approach for restoration of islet cell mass is enhancement of endogenous regenerative capacity of endocrine pancreas. Recent results in rodents and humans suggest that pancreas has an extensive capacity to regenerate after injury [24]. In fact, it has been hypothesized that diabetes might result from ß-cell destruction overpowering ß-cell regeneration and that even a long time after the onset of the disease, ß-cell regeneration might still take place [4]. It thus might be possible to restore ß-cell mass in patients with diabetes by shifting the equilibrium between regeneration and destruction in the direction of regeneration.

Many adult mammalian organs contain a reservoir of tissue-specific stem and progenitor cells [5]. Throughout the life of an organism, stem and progenitor cells are used for replenishing the differentiated cell mass to compensate for cell loss during normal cell turnover and after organ damage. Although it is thought that cell replacement occurs primarily via differentiation of pre-existing resident organ-specific stem and progenitor cells, there are some notable exceptions. For example, it has been shown that adult mammalian liver can efficiently regenerate as a result of proliferation of mature hepatocytes [6]. Also, in lower vertebrates, limb regeneration after injury occurs via dedifferentiation of mature tissue into transient stem cells, which expand and redifferentiate to regenerate the missing limb [7]. Whether similar transitions occur in higher vertebrates remains to be determined.

During embryogenesis, the pancreas is derived from the endoderm [8]. Neural cells, on the other hand, are derived from ectoderm. Despite their different embryological origins, pancreatic and neural cells express many common enzymes and other markers and have similarities in developmental control mechanisms [814]. An intermediate filament protein, nestin, a marker of neural stem and progenitor cells [15], is also expressed in pancreas. Recently it has been proposed that nestin may mark pancreatic stem or progenitor cells [13, 16, 17]. This claim was challenged, however, by others studies that suggest that nestin is expressed in pancreatic mesenchyme and not in the epithelium from which pancreatic endocrine cells are thought to originate [1823].

It has been argued that in the mammalian pancreas, new hormone-producing cells arise either through islet cell replication or through differentiation from progenitor and stem cells via a process called islet neogenesis [3]. Because new islets often arise in close proximity to pancreatic ducts, it has been suggested that pancreatic stem or progenitor cells might reside within the ducts [24]. However, recent results do not support this hypothesis [25,26]. Rigorous testing of the origins of cells that can give rise to new islet cells is complicated by the lack of specific markers for the putative pancreatic stem and progenitor cells and by the difficulty of following individual cells’fate in the pancreas. An in vitro differentiation system allowing generation of new pancreatic endocrine cells would greatly benefit this work [8, 2729].

In this study we present a new in vitro differentiation system derived from adult mouse islet-enriched fractions (IEFs). When IEFs are cultured on adhesive substrates, they first generate a heterogeneous population of proliferating cells. After aggregation, the IEF-derived cells form three-dimensional islet-like cell clusters (ILCCs), which produce insulin/C-peptide and other islet endocrine hormones, glucagons, and somatostatin. Our results show that new hormone-producing cells are actively generated in this in vitro system. Moreover, we show that embryonic-like cells exhibiting neural and stem cell properties arise in the IEF cultures. These findings uncover a previously unrecognized capacity of adult pancreas to acquire embryonic phenotype and to generate pancreatic and nonpancreatic progeny.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 
Cell Culture
Mouse IEF fractions (C57BL/6J and FVB/NJ3, both from Jackson Laboratory, Bar Harbor, ME) were isolated from pancreas perfused with collagenase V (Sigma, St. Louis) using described protocols [30]. Depending on the preparation, the islet content of the IEFs ranged from 60%–80% (as determined by staining with Zn2+ binding agent, diphenyl thiocarbazone dithizone, Sigma). To monitor insulin production, small aliquots of the cell culture at different stages of development were removed for determination of intracellular C-peptide content. The cells were cultured as described [31,32], with some modifications. Specifically, the IEFs (500 cell clusters per 60-mm dish) were plated in tissue culture-grade dishes precoated overnight with polyornithine/bovine fibronectin (polyornithine 10 µg/ml, fibronectin 2 µg/ml, Sigma) and concanavalin A (1 µg/ml, Sigma) in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum (both from Invitrogen, Carlsbad, CA; stage 1; Fig. 1AGo). After 48 hours in serum-containing medium, from 50%–80% of IEFs attach to the tissue culture dishes. At this time, the serum-containing medium was replaced with the serum-free insulin, transferrin, selenium, and fibronectin media [31] containing 20 ng/ml of basic fibroblast growth factor (bFGF; R&D systems, Minneapolis) and 1,400 U/ml of leukemia inhibitory factor (LIF; Chemicon, Temecula, CA). Serum-free medium was used throughout the remaining culture period. After an additional 7–10 days (stage 1), the cells were removed from tissue culture dishes using mild trypsin digestion for 5 minutes at 37°C (0.05% trypsin/0.53 mM EDTA, Invitrogen) and replated at high density (2 x 105/cm2) or low density (3 to 4 x 104/cm2) on tissue culture plastic or glass coverslips pre-coated with polyornithine/laminin-1 (laminin at 1 µg/ml, Becton, Dickinson Labware, Bedford, MA) or polyornithine/fibronectin, as in stage 1, in N2 medium [31] containing B27 (Invitrogen), 10 mM nicotinamide (Sigma), and 20 ng/ml of bFGF. For stages 2 and 3, the cells were cultured for an additional 6–10 days; bFGF was added to the medium during the first 4–5 days of culture (stage 2) and later removed for the duration of the experiment (stage 3).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 1. Pancreatic phenotype of IEF cultures. (A): General scheme of the differentiation protocol used for generation of islet-like cell clusters. The conditions optimized for pancreatic differentiation are shown in bold. (B): Concentration of C-peptide at the end of IEF cultures maintained under different conditions, as indicated in (A). Shown are the results of two independent experiments. The cells were collected for C-peptide analysis on different days, as indicated on top of the Figure. The results are represented as mean ± standard deviation of two independent samples, each measured in duplicates. (C): Four left panels: morphology of IEF culture maintained under different conditions, as shown in (A). Shown are phase-contrast images of typical microscopic fields (Zeiss Axiovert 200). Scale bar = 100 µm. Far right: immunocytochemical analysis of C-peptide and PDX-1 expression of stage 3 cultures (Zeiss LSM510 laser confocal microscope). Scale bar = 50 µm. (D): Intracellular C-peptide content at different stages of culture. (E): Intracellular C-peptide concentration at different stages of culture. (D) and (E) show the results of three independent experiments. The cells were collected for C-peptide analysis on different days, as shown in (E). (F): Release of C-peptide in response to glucose in vitro. C-peptide release was measured in day 15 IEF cultures in 15-minute static incubations, as described in Materials and Methods. Each experimental point in (D), (E), and (F) is derived from analyzing three independent samples, each measured in duplicate. The results are presented as mean ± standard deviation. Abbreviations: bGFG, basic fibroblast growth factor; Fn, fibronectin; IEF, islet-enriched fraction; ILCC, islet-like cell cluster; ITSFn, insulin, transferrin, selenium, and fibronectin; Lam, laminin.

 
Immunocytochemistry
Cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 minutes at room temperature. Depending on the primary antibody, the cells were either permeablized in 0.3% Triton X-100 and blocked in PBS/10% normal goat or donkey serum for 1 hour at room temperature or treated with 100% cold methanol on ice for 10 minutes and blocked with PBS/10% normal goat or donkey serum. The primary and secondary antibody reactions were carried out using standard protocols. Antibody reactions with secondary antibodies alone (omitting primary antibody) were used as negative controls. The following primary antibodies were used at the following dilutions: nestin rabbit polyclonal, 1:50 (gift of Ron McKay, National Institute of Neurological Disorders and Stroke, National Institutes of Health); nestin mouse monoclonal (BD Biosciences Pharmingen, San Diego) and insulin mouse monoclonal, 1:1,000 (Sigma); insulin guinea pig polyclonal, 1:100 (DAKO); C-peptide rabbit polyclonal, 1:100 (Linco Research, Inc., St. Charles, MO); glucagon rabbit polyclonal, 1:100 (DAKO); TUJ1 rabbit polyclonal, 1:2,000 (Babco, Richmond, CA); PDX-1 rabbit polyclonal, 1:2,000 (gifts from Joel Habener, Harvard University, and Chris Wright, Vanderbilt University); somatostatin sheep polyclonal, 1:500 (American Research Products, Inc., Belmont, MA); bromodeoxyurindine (BrdU) and rat monoclonal, 1:100 (Accurate Chemical and Scientific Corp., Westbury, NY); RC2 mouse monoclonal immunoglobulin M, 1:1,000 (Developmental Studies Hybridoma Bank, Iowa City, IA); S100ß rabbit polyclonal, 1:50 (DAKO); caspase-3 rabbit polyclonal, 1:2,000 (R&D Systems); and 1:100 rabbit polyclonal (gift from William Pavan, National Human Genome Research Institute, National Institutes of Health). For detection of primary antibodies, Alexa Fluor 488-conjugated (green, Molecular Probes, Inc., Eugene, OR) and CY-3–conjugated (red, Jackson Immunoresearch Laboratories, West Grove, PA) secondary antibodies were used according to the methods recommended by the manufacturers. Images were captured using Zeiss Axiovert 2 plus upright microscope with Zeiss AxioCam HRc digital camera, Zeiss Axiovert 200 inverted microscope with Nikon Coolpix995 digital camera, and Zeiss LSM510 laser-scanning confocal microscope, as specified in the Figure legends.

BrdU Labeling and Pulse Chase Experiments
BrdU was dissolved in PBS and added to the cultures at a final concentration of 10 µM. The cells were labeled with BrdU in one 24-hour pulse (day 6) followed by culture for additional time without BrdU in the media. In other experiments, BrdU was added to the cultures for 2-, 6-, or 24-hour pulse followed by immediate cell fixation. For BrdU immunocytochemistry, the cells were treated with 2 M HCl for 45 minutes at room temperature, neutralized with 0.1 M sodium borate (pH 8.5) for 15 minutes, and reacted with primary and secondary antibodies using standard protocols.

C-Peptide Measurement and C-Peptide Release Assay
The total intracellular C-peptide content of the culture and C-peptide concentration per microgram of cellular protein was determined using rat C-peptide RIA kit (Linco Research, Inc.). Protein concentration in the samples was determined using BioRad Protein Assay kit (Bio-Rad Laboratories, Hercules, CA) following the manufacturer’s instructions. The C-peptide release assay was carried out in static 15-minute incubations, as described previously [32]. The amount of intracellular C-peptide and C-peptide released in the medium in response to glucose was determined using C-peptide RIA kit, as above. The values of C-peptide released in the medium were normalized per microgram of intracellular protein for the corresponding samples. The results are presented as mean of triplicate samples each determined in duplicate measurements ± standard deviation.

Apoptosis Assay
Caspase-3 and -7 protease activity was determined using the Caspase-Glo 3/7 Assay Kit (Promega, Madison, WI) following the manufacturer’s instructions. Briefly, the cells were washed in PBS, frozen at –80°C, and, after thawing, solubilized in Caspase-Glo 3/7 reagent containing luciferase and luminogenic substrate (Z-DEVD). The reactions were incubated at 37°C for 30 minutes, and the cleavage of the substrate by caspase-3 and -7 was detected using luminometer (BioOrbit, Turku, Finland). The readings for the blank controls were subtracted from the experimental readings, and the relative light units produced at different time points of the culture were normalized per microgram of protein in the reaction. To obtain the final values of percentages of apoptotic cells at different time points of culture, we immunostained day-10 IEF culture with caspase-3 antibody (R&D Systems) and calculated the percentage of caspase-3+ cells by counting caspase-3+ cell number and total cell number in 10 random microscopic fields (day 10 was chosen for counting, because IEF cultures exhibited minimal three-dimensional architecture at the end of stage 1; see the Results section). This allowed us to calculate a coefficient, percent of caspase-3+ cells per relative light unit. We then used this coefficient and the values of light units measured in Caspase-Glo assay at different time points for the calculations of percentages of apoptotic cells at different time points of culture.

Reverse Transcription–Polymerase Chain Reaction
The total cellular RNA was isolated using RNEasy kit (Qiagen, Valencia, CA). To avoid a potential contribution from traces of genomic DNA to the polymerase chain reaction (PCR) signal, we removed traces of DNA from the RNA samples with DNA-freeTM DNase (Ambion, Austin, TX). The RNA was reverse transcribed into cDNA using Superscript II reverse transcriptase (RT; Invitrogen) and random hexamers (Invitrogen) according to the manufacturer’s instructions. The PCRs were performed in 25 µl reaction volume using Taq DNA polymerase (Invitrogen). To additionally control for an unlikely contamination with genomic DNA, we included in our analysis the "RT (day 10)" samples (Fig. 2Go). These were mock cDNA samples prepared using day 10 RNA, omitting RT from the cDNA reaction mixture. Moreover, when possible, the sequences of gene-specific primers were chosen to span introns. (Among all of the primers, only Bmi-1–specific and Sip1-specific primers do not span introns.) To determine the optimal cycle number in the linear range of PCR amplification, for each set of primers, the initial PCR reactions were carried out at several different cycle numbers. Also, to assure semiquantitative RT-PCR analysis, we first normalized cDNA concentration in different cDNA samples by relative expression of an internal control, 18S rRNA. We then chose the amount of input cDNA for other genes accordingly.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Cells in IEF cultures undergo active turnover. (A): Time course of cell proliferation in IEF cultures. Cell proliferation was determined by pulsing the cells for 6 hours with BrdU followed by immediate fixation and measurement of BrdU incorporation by immunocytochemistry. For each time point, the results are presented as a percentage of BrdU-positive cells in 10 randomly selected microscopic fields. Large standard deviations reflect heterogeneity in the level of BrdU incorporation between the counted fields. Typical result of BrdU immunocytochemical analysis of day-5 culture is shown on the right. The inset shows split image of BrdU and 4', 6'-diamidino-2-phenylindole immunocytochemistry for the portion of the same microscopic field. (B): Time course of cell apoptosis in IEF cultures. Level of apoptosis was measured using Caspase-Glo 3/7 Assay Kit (Promega), and caspase-3 immunocytochemistry, as described in Materials and Methods. The results are presented as mean ± standard deviations of duplicate measurements for days 0, 2, 5, and 10 and triplicate measurements for days 12 and 14. Typical result of C-peptide/caspase-3 immunocytochemistry on day 4 is shown on the right. Abbreviations: BrdU, bromodeoxyurindine; IEF, islet-enriched fraction.

 
The expected fragment sizes and the optimal PCR cycle numbers used were as follows: 18s rRNA, tcaagaacgaaagtcggagg and ggacatctaagggcatcaca (488), 20 cycles; insulin 1, tagtgaccagctataatcagag and acgccaaggtctgaaggtcc (288), 25 cycles; insulin 2, ccctgctggccctgctctt and aggtctgaaggtcacctgct (212), 25 cycles; glucagon, actcacagggcacattcacc and ccagttgatgaagtccctgg (352), 30 cycles; somatostatin, tcgctgctgcctgaggacct and gccaagaagtacttggccagttc (232), 30 cycles; glial fibrillary acidic protein (GFAP), ccatgccacgtt tctccttg and ctgcagttggcggcgatag (772), 30 cycles; S100ß, tactcggacactgaagccagag and gtctcactcatgttcaaagaac (338), 30 cycles; nestin, gaatcagatcgctcagatcc and gcacgacaccagtagaactgg (483), 30 cycles; Oct-4, ggcgttctctttggaaaggtg and ctcgaaccacatccttctct (312), 35 cycles; Nanog, agggtctgctactgagatgctctg and caaccactggtttttctgccaccg (363), 35 cycles; FoxD3 cgacgacgggctggaggagaa and atgagcgcgatgtaagggtag (326), 35 cycles; Bcrp1/ABCG2, ccatagccacaggccaaagt and gggccacatgattcttccac (327), 35 cycles; Bmi-1, agcagcaat-gactgtgatgcacttgag and gctctccagcattcgtcagtccatccc (244), 35 cycles; Sox 2, ggcagctacagcatgatgcaggagc and ctggtcatggagttgtactgcagg (130), 35 cycles; Sox 10, aggacggcgaggcagacgatg and ggtggtccaggtgggcactcttgta (467), 30 cycles; Pax 6, cagtcacagcggagtgaatc and cgcttcagctgaagtcgcat (658), 30 cycles; Snail, gtctgcacgacctgtggaaa and gactcttggtgcttgtggag (229), 30 cycles; Sip1, ccgagaaaggactgacaagc and agcctgagaggaggatcaca (358), 30 cycles; Slug, gcgaactggacacacacacagttat and ccccagtgtgagttctaatgtgtcc (572), 30 cycles; and Twist, acgagctggactccaagatg and cctctgggaatctctgtcca (346), 35 cycles.

Cell Counting
For cell counting, specific marker-positive cells were counted in 10 random microscopic fields. The results are presented as a mean of 10 counted fields ± standard deviation. When cells of interest were present in three-dimensional clusters, we counted them in individual optical sections in images captured by a laser confocal microscope (Zeiss LSM510). We spaced the counted optical sections in a given confocal Z stack, making sure not to count the same cell twice.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 
ILCCs Exhibit Phenotype of Rodent Islets
To examine the potential of adult mouse pancreas to generate new hormone-producing cells, we cultured IEFs using a modification of protocols previously shown to promote neural differentiation of central nervous system (CNS) stem cells and pancreatic differentiation of embryonic stem cells [3133]. When freshly isolated IEFs are cultured on fibronectin in fetal bovine serum–free medium, in the presence of bFGF and LIF, they lose their three-dimensional architecture and generate morphologically heterogeneous rapidly proliferating cell populations (Fig. 1AGo; also see Materials and Methods for detailed description of the culturing protocol). Notably, cells with neural-like morphology are a common feature of stage 1 cultures (see below). When the cells are replated at high density on laminin-1 at the end of stage 1, they gradually aggregate to form three-dimensional ILCCs. If, however, the same cells are replated at low density on either laminin-1 or fibronectin or at high density on fibronectin, the ILCC formation is inefficient (Figs. 1B, 1CGo). If the cells are not replated at the end of stage 1 but are continually maintained on fibronectin, no ILCC formation is observed. Instead, neural-like cells become a predominant cell type (unpublished data).

To quantify the effect of different culture conditions on ILCC differentiation, we compared intracellular C-peptide concentration after culturing stage 2 cells at high versus low density and on laminin-1 versus fibronectin. We chose to measure C-peptide rather than insulin to eliminate a potential contribution to the signal from the bovine insulin present in the culture media [34]. Because, as a result of proteolytic processing of proinsulin, insulin and C-peptide are generated in equimolar quantities, the C-peptide production is a reflection of insulin production. When measured at the end of the culture in two independent experiments, the concentration of C-peptide in high-density laminin-1 cultures is 2- to 3.5-times higher than its concentration in high-density fibronectin cultures (Fig. 1BGo). If the cells are cultured on fibronectin at low density, the C-peptide concentration drops an additional 2- to 10-fold. Furthermore, when cells are cultured at low density on laminin, the concentration of C-peptide is reduced two to five times compared with cultures at high density on laminin. These results suggest that both cell–cell and cell–extracellular matrix interactions may be playing a functional role in this differentiation system. Given our finding that high-density laminin-1 cultures result in the best outcome, we used these conditions for all of the subsequent experiments described below.

To investigate the dynamics of C-peptide production during the culture, we compared intracellular C-peptide concentration per microgram of protein and total intracellular C-peptide content of fresh IEFs with those of cultured IEFs at the end of stages 1 and 3 (the latter value reflects the amount of C-peptide present in the whole-cell preparation at a given stage of culture). The results of three independent experiments (Figs. 1D, 1EGo) demonstrate that at the end of stage 1, the cultures become largely depleted of C-peptide. Our results suggest that increase in the rate of apoptosis as well as reduced hormone production by the IEFs is responsible for the observed C-peptide depletion of late stage 1 cultures (see below). The reduction in C-peptide level is followed by its increase at the end of the culture.

Immunocytochemical analysis of C-peptide and ß cell–specific transcription factor PDX-1 [35,36] shows that, similar to native ß cells, C-peptide+ cells exhibit nuclear localization of PDX-1 (Fig. 1CGo, right side). Using immunocytochemistry, we have additionally found that other islet hormones, glucagon and somatostatin, are also produced by the ILCCs (unpublished data and Fig. 3BGo). Our analysis of functional maturation of the ILCCs shows that they release C-peptide in response to glucose with kinetics characteristic of normal islets (Fig. 1FGo). At 16.7 mM glucose, the release of C-peptide is nearly fivefold higher than that at the baseline, at 5 mM glucose.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. New hormone cells are generated in IEF cultures. Each row shows split images of the same microscopic field. Left, immunostaining for the markers, as indicated; right, nuclear DAPI staining. (A): Immunocytochemical analysis of C-peptide/BrdU 24-hour pulse experiment. Several C-peptide+/BrdU+ cells and their corresponding nuclei on the left are marked with arrowheads. Scale bar = 20 µm (Zeiss Axiovert 2 Plus). (B): BrdU pulse chase analysis of endocrine hormone-producing cells. Top, general scheme of BrdU pulse chase analysis. Immunocytochemical analysis of hormone+/BrdU+ cells. Several hormone+/BrdU+ cells and their corresponding nuclei on the right are marked with arrowheads (Zeiss LSM510). Scale bar = 20 µm. Abbreviations: BrdU, bromodeoxyurindine; IEF, islet-enriched fraction; IHC, immunohistochemistry.

 
Expression of islet hormone-specific mRNAs during different stages of culture development was analyzed by RT-PCR (Fig. 2Go). In contrast to the C-peptide levels, the steady-state levels of these mRNAs do not change significantly during the culture period. Enumeration of C-peptide, glucagon, and somatostatin-expressing cells (Tables 1AGo and 1BGo) shows that the percentage of C-peptide–expressing cells in the culture increases between the end of stages 1 and 3. Also, at the end of stage 3, the relative ratios of different hormone-expressing cells approximate those of the rodent islets. In summary, these results demonstrate that ILCCs have phenotypic characteristics similar to those of native islets.


View this table:
[in this window]
[in a new window]
 
Table 1A. Enumeration of endocrine hormone-producing cells
 

View this table:
[in this window]
[in a new window]
 
Table 1B. Enumeration of BrdU+ cells within endocrine- and neural-like cell populations
 
Extensive Cell Proliferation and Apoptosis Take Place during Stage 1
We next investigated the extent of contribution of the input IEF cell pool to the ILCCs obtained at the end of the culture. To this end, we measured cellular proliferation and apoptosis during the course of the IEF cultures. For cell proliferation analysis, the cells were pulsed for 6 hours with thymidine analog, BrdU, which incorporates into DNA of the replicating cells. After the pulse, the cells were fixed, and the incorporated BrdU was detected using immunocytochemistry with BrdU-specific antibody. Quantitative analysis of BrdU incorporation (Fig. 2AGo) demonstrates that cells in the IEF cultures proliferate throughout the culturing period. The peak of proliferation occurs between days 4 and 6 of stage 1. During this time window, 40%–50% of all cells in the culture become BrdU positive after 6h pulse. Most of the proliferating cells are found either in or around the flattened cells clusters, which lost their three-dimensional architecture. Occasionally we find proliferating cells at the periphery of three-dimensional clusters. Only few proliferating cells are detected within an interior of the three-dimensional clusters (Fig. 2AGo, right side of the panel; also see Fig. 2AGo).

The level of apoptosis was estimated using Caspase-GloTM luminescent assay (Promega), which measures caspase-3 and caspase-7 activity in cell lysates. Caspase-3 and -7 proteases are key effectors of apoptosis in mammalian cells [37]. The results (Fig. 2BGo) show that the input IEF population contains a large proportion of apoptotic cells. Also, early stage 1 cultures undergo active apoptosis. Moreover, we found that in early stage 1 cultures, a large fraction of C-peptide–expressing cells coexpress caspase 3 (Fig. 2BGo, right side of the panel). Overall, the results of BrdU incorporation and apoptosis analysis demonstrate that cell proliferation accompanied by extensive apoptosis takes place during stage 1 of IEF culture. They suggest that stage 3 cultures become considerably depleted of the input IEF cells.

New Islet-Like Cells Are Generated in IEF Cultures
To examine if new C-peptide/insulin-producing cells are generated during the course of IEF culture, we carried out BrdU pulse and BrdU pulse chase analysis of C-peptide–expressing cells. When we pulsed stage 1 cultures with BrdU for 2 hours, we could not detect any double-labeled C-peptide+/BrdU+ cells (unpublished results). However, when the BrdU pulse was extended to 24 hours, both C-peptide+/ BrdU+ and insulin+/BrdU+ cells were detected (Fig. 3AGo and unpublished data). These double-labeled cells appear primarily within flattened epithelial clusters, which are a common feature of early stage 1 cultures. These double-labeled cells are often found at the clusters’ periphery, and they appear to exhibit a reduced immunoreactivity to C-peptide antibody. These results indicate that ß cells may be losing C-peptide expression as they divide in culture.

The scheme of BrdU pulse chase analysis is shown at the top of Figure 3BGo. The cells were pulsed with BrdU during stage 1 for 24 hours and then were maintained without BrdU for the remainder of the experiment. The results of this experiment (Fig. 3BGo) demonstrate that a subpopulation of stage 3 C-peptide, glucagon, and somatostatin-expressing cells is derived from the proliferating cells. In particular, our quantitative analysis shows that between 20% and 40% of stage 3 hormone-expressing cells are derived from proliferating cells (Tables 1AGo and 1BGo). We obtained similar results in at least three independent experiments. In summary, the results of BrdU pulse and BrdU pulse chase analysis indicate that new hormone-producing cells are generated during the course of the IEF cultures.

Stage 1 Cultures Express a Wide Range of Embryonic Neural and Stem Cell Genes
As described above, we observe morphologically heterogeneous neural-like cells in stage 1 cultures. We decided to examine if indeed these cells express neural-specific markers. In addition to the neural progenitor cell marker, nestin, we examined a marker of astrocytes, GFAP [38]; a marker of early neurons, neuronal-specific ß III subunit of ß-tubulin recognized by TUJ1 antibody [39]; a marker of embryonic neural crest, transcription factor Sox10 [40]; and a marker of oligodendrocytic progenitors, O4 [41]. We also examined expression of neuroepithelial and radial glial cell marker of embryonic CNS, RC-2 [42,43]. Notably, in the embryonic brain, radial glia is thought to possess stem cell properties [44,45]. The results of immunocytochemical analysis (Fig. 4Go) show that all the examined markers are abundantly expressed at the end of stage 1 in a partially overlapping pattern. For example, we detect distinct subpopulations of nestin+ cells expressing TUJ1 and GFAP. Most O4+ cells found within cell clusters do not coexpress GFAP. We found that, similar to adult brain [46], adult IEFs do not express RC-2 (unpublished data). In contrast, an abundant population of RC-2+/nestin+ cells is found in late stage 1 cultures (Figs. 4E, 4FGo). Reminiscently of their arrangement in the embryonic brain, these cells are organized in parallel cell bundles. Moreover, similarly to mouse CNS, most RC-2+ cells do not express GFAP [47] (Fig. 4FGo). The results of BrdU lineage tracing analysis show that most TUJ1, RC-2, nestin, and GFAP cells are derived from proliferating cell populations (Table 1BGo) and thus are generated de novo during the course of the culture.



View larger version (81K):
[in this window]
[in a new window]
 
Figure 4. IEF cultures exhibit neural phenotype. (A–F): Expression of neural markers in day-10 IEF cultures. Image in (A) was obtained with Zeiss Axiovert 2 Plus; images in (B), (C), (D), (E), and (F) were obtained with Zeiss LSM510. Scale bars = 50 µm. Abbreviations: GFAP, glial fibrillary acidic protein; IEF, islet-enriched fraction.

 
Neural and stem cell phenotype of IEF cultures was analyzed additionally by RT-PCR (Fig. 5Go). The results demonstrate that expression of GFAP, nestin, and astrocytic marker, Ca2+ binding protein S100ß [48], peaks at the end of stage 1 and falls at the end of the culture. This pattern of expression was also confirmed by immunocytochemistry (unpublished data). Having found neural embryonic-like cells in these adult pancreatic cultures, we decided to expand the RT-PCR analysis to a wider panel of stem cell–specific and other early developmental genes (Table 2Go). Our results show that by the end of stage 1, the IEF cultures initiate expression of many genes associated with embryonic and stem cell phenotype. For example, we detect a marker of side population, the ABC pump Bcrp1/Abcg2 [49], which is found in a variety of multipotent stem cell types. Although the day 0 cDNA preparation used for the RT-PCR analysis shown in Figure 5Go is negative for Bcrp1/Abcg2, we detected Bcrp1/Abcg2 signal in other day-0 cDNA preparations. Further, Bmi1, a polycomb-group transcriptional repressor required for the maintenance of adult stem cells in several tissues [50,51], is upregulated during stage 1. Interestingly, we also detect the Bmi1 signal in IEFs before culture initiation. To our knowledge, expression of Bmi1 in adult pancreas has not been previously documented.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 5. IEF cultures express a wide range pancreatic, neural, and stem cell–specific genes. Time-course RT-PCR analysis of pancreatic, neural, and stem cell gene expression. Negative control PCR amplifications, "RT (day 10)," were carried out with mock cDNA samples, which were prepared with day-10 RNA, omitting RT from the cDNA reaction mixture. The results in the two panels shown were obtained with two independent RNA time courses. Similar results for the markers shown were obtained in at least three independents experiments. Abbreviations:GFAP, glial fibrillary acidic protein; IEF, islet-enriched fraction; RT-PCR, reverse transcriptase–polymerase chain reaction.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Neural and stem cell markers shown in Figure 5Go
 
Transient induction of markers of ES cells/preimplantation embryo, Oct-4, nanog, Sox2, and FoxD3 [5256] is particularly intriguing. It suggests that a short-lived ES-like sub-population may be present in late-stage 1 IEF cultures. Because, in addition to expression in the embryonic stem cells, Sox2 and FoxD3 are also expressed in embryonic neural crest, perhaps a portion of Sox2 and FoxD3 signal can be attributed to a neural crest–like cell population that arises in the IEF cultures. In fact, we have found that other neural crest–specific mRNAs, Twist, Snail, Slug, Sip1, and Sox10 (see also Fig. 4CGo) [40, 5760], are induced during stage 1 (Fig. 5Go). We reproducibly observed a similar mRNA expression pattern for all of the examined markers in different independent IEF in vitro culture experiments.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 
Pancreatic Phenotype of IEF Cultures
In this work, we show that adult mouse IEFs cultured in serum-free medium in the presence of LIF and bFGF can generate actively proliferating cell populations. When plated at high density on laminin-1, these cells give rise to the three-dimensional ILCCs expressing insulin, glucagon, and somatostatin. Upon glucose stimulation, the ILCCs secrete C-peptide with kinetics approximating those of the native islets. We also show that the C-peptide–expressing ß-like cells coexpress PDX-1 and that intracellular C-peptide concentration of stage 3 cultures is within a range of that of the input IEFs, implying that ILCCs produce physiological levels of C-peptide/insulin. In individual experiments, the final intracellular C-peptide concentration of stage 3 cultures varied more than fivefold to sixfold. It is likely that these differences result from experiment-to-experiment cell-type variability of the input IEFs and from unequal proliferation/ differentiation/survival capacity of the different cell types. Thus, even small differences in the initial composition of IEFs would translate into large differences in the outcome of the culture.

We chose to use heterogeneous islet-containing IEFs rather than islet-depleted pancreatic fractions used by several other investigators [61,62]. First, islets themselves may contain pancreatic progenitor cells [25,29]. Second, islet endocrine cells may have a capacity to undergo cell division and to generate new endocrine-like cells [26, 63, 64]. Third, cell–cell interaction between islet and extra-islet cell types may promote pancreatic differentiation and morphogenesis. We cannot rule out that a fraction of input endocrine cells survives until the end of the culture. However, because of active apoptosis and cell proliferation during stage 1, our results strongly suggest that such contamination should not be a major source of endocrine-like cells comprising the ILCCs. Most important, the BrdU pulse chase analysis demonstrates that a substantial portion of hormone-expressing cells detected at the end of the culture is generated de novo. Our culturing protocol in the current form does not allow an overall expansion of hormone-producing cell mass, i.e., the C-peptide level and the concentration at the beginning and at the end of the culture are similar. Clearly, for practical applications to expansion of islets in vitro, it will be important to overcome this limitation. Nevertheless, the lack of hormone cell expansion does not diminish the value of this in vitro differentiation system as an experimental tool to investigate the mechanisms of generation of new endocrine pancreatic cells.

Neural and Stem Cell Phenotype of IEF Cultures
We have found that in parallel with the ILCCs, new neuronal-and astrocytic-like cells are generated in the IEF cultures. By varying cell plating density and extracellular matrix composition during stages 2 and 3, we can enrich cultures for neural versus islet-like cell types. Whereas low cell density and fibronectin favor generation of neural cells, high cell density and laminin-1 favor generation of islet-like cells. Given that we have not detected significant expression of markers of mature neurons (unpublished data); we conclude that most neuronal-like cells are developmentally immature. This immaturity is not surprising—after all, we made no attempt to optimize culture conditions to promote terminal neuronal differentiation.

Similarly to the adult mammalian CNS, in which RC-2 is not expressed [46], we detected no RC-2 immunoreactivity in the IEFs before culture initiation. Conversely, the RC-2+/nestin+ cells were abundant in late stage 1 cultures. Also present at the end of stage 1 was a constellation of embryonic stem cell, multipotential stem cell, and embryonic neural crest mRNAs. Notably, one of the neural markers, Sox10, was recently identified in the embryonic pancreas but not in the adult pancreas [65]. Collectively, these results strongly suggest that in late-stage 1 IEF cultures, there exists a sub-population of cells with embryonic and multipotential stem cell properties. Although expression of several neural and embryonic stem cell mRNAs is drastically reduced during ILCC morphogenesis, expression of neural crest mRNAs, Slug, Snail, Twist, and Sox10 remains high. Sustained expression of these embryonic genes suggests that a fraction of cells still retain their immature phenotype at the end of the culture.

The embryonic and stem-like cell types that we found in the adult pancreatic cultures have not been described before. These findings were entirely unexpected. It will be important to elucidate the mechanisms responsible for generation of these cells, such as whether these cells arise through an expansion of a small population of stem cells pre-existing in adult pancreas or are derived from mature cell types. It will also be important to investigate the nature of proliferating cells giving rise to the endocrine-like cells. First, these cells may originate from hormone-negative pancreatic stem/progenitor cells residing in the pancreas. Second, similarly to the situation in adult liver [6], and as recently reported in adult mouse pancreas [26], in our cultures mature endocrine cells may replicate and generate new endocrine-like cells. Third, the new cells may be derived from mature endocrine cells through dedifferentiation and redifferentiation in a manner similar to limb regeneration in lower vertebrates [7]. In fact, our results of BrdU pulse analysis of C-peptide–expressing cells are compatible with the two latter models.

The observed difference between the v-shaped kinetics of C-peptide and the flat kinetics of insulin and other hormone-specific mRNA expression also could be explained within the context of the two latter models. For example, one could speculate that endocrine cells replicating during stage 1 may maintain the rate of islet-specific gene transcription but downregulate translation of the islet-specific genes. This translational inhibition is then followed by the recovery of islet-specific translation during stages 2 and 3.

Finally, our work raises questions about possible lineage relationships between the late stage 1 stem-like cells, neural cell types, and hormone-producing cells. Specifically, do these cell types arise from a common progenitor, through interconversion via transdifferentiation, or independently from each other? Because the input cell population of the IEF cultures is heterogeneous, the conclusive answers to these questions could only come from lineage tracing and clonal analysis. This said, independent of whether the stem-like, neural, and pancreatic cells are related to each other, this work establishes a novel model system to investigate the mechanisms of generation of new endocrine hormone-producing cells and uncovers a previously unknown potential of adult pancreas to give rise to cells with multipotential stem cell and neural properties. We anticipate that these findings will have important implications for our understanding of the mechanisms of pancreatic development and regeneration.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 
We thank David Harlan, Marvin Gershengorn, and Derek LeRoith for their comments on the manuscript and Arnold Kriegstein for helpful discussions. We are grateful to Ron McKay for the gift of anti-nestin antibody, Chris Wright and Joel Habener for the gifts of anti-PDX-1 antibodies, and Bill Pavan for anti-Sox10 antibody. We thank Oksana Gavrilova and Stephanie Pack for their help with IEF isolations, Carolyn Smith for her help with laser scanning confocal microscopy, and Cheol Hong Park and Kristina Buac for their help with cell culture and preparation of the Figures.

A work supporting our finding of neural differentiation capacity of adult mouse pancreas (Seaberg, R.M. et al. Clonal Identification of Multipotent Precursors from Adult Mouse Pancreas that Generate Neural and Pancreatic Lineages. Nature Biotechnology 22, 1115–1124, 2004) had appeared in print after our manuscript was accepted for pulication.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 RESULTS
 Discussion
 References
 

  1. Shapiro AM, Lakey JR, Ryan EA et al. Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 2000; 343:230–238.[Abstract/Free Full Text]

  2. Sharma A, Zangen DH, Reitz P et al. The homeodomain protein IDX-1 increases after an early burst of proliferation during pancreatic regeneration. Diabetes 1999;48:507–513.[Abstract]

  3. Bonner-Weir S. Life and death of the pancreatic beta cells. Trends Endocrinol Metab 2000;11:375–378.[CrossRef][Medline]

  4. Ritzel RA, Butler PC. Replication increases beta-cell vulnerability to human islet amyloid polypeptide-induced apoptosis. Diabetes 2003;52:1701–1708.[Abstract/Free Full Text]

  5. Weissman IL, Anderson DJ, Gage F. Stem and progenitor cells: origins, phenotypes, lineage commitments, and trans-differentiations. Annu Rev Cell Dev Biol 2001;17:387–403.[CrossRef][Medline]

  6. Alison MR, Poulsom R, Forbes SJ. Update on hepatic stem cells. Liver 2001;21:367–373.[CrossRef][Medline]

  7. Bryant SV, Endo T, Gardiner DM. Vertebrate limb regeneration and the origin of limb stem cells. Int J Dev Biol 2002; 46:887–896.[Medline]

  8. Slack JM. Developmental biology of the pancreas. Development 1995;121:1569–1580.[Abstract]

  9. Yokoyama-Hayashi K, Takahashi T, Kakita A et al. Expression of PGP9.5 in ductal cells of the rat pancreas during development and regeneration: can it be a marker for pancreatic progenitor cells? Endocr J 2002;49:61–74.[Medline]

  10. Schwitzgebel VM, Scheel DW, Conners JR et al. Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development 2000;127:3533–3542.[Abstract]

  11. Kim SK, Hebrok M, Melton DA. Notochord to endoderm signaling is required for pancreas development. Development 1997;124:4243–4252.[Abstract]

  12. Rulifson EJ, Kim SK, Nusse R. Ablation of insulin-producing neurons in flies: growth and diabetic phenotypes. Science 2002;296:1118–1120.[Abstract/Free Full Text]

  13. Zulewski H, Abraham EJ, Gerlach MJ et al. Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 2001;50:521–533.[Abstract/Free Full Text]

  14. Zhang X, Heaney S, Maas RL. Creloxp fate-mapping of Pax6 enhancer active retinal and pancreatic progenitors. Genesis 2003;35:22–30.[CrossRef][Medline]

  15. Lendahl U, Zimmerman LB, McKay RD. CNS stem cells express a new class of intermediate filament protein. Cell 1990;60:585–595.[CrossRef][Medline]

  16. Abraham EJ, Leech CA, Lin JC et al. Insulinotropic hormone glucagon-like peptide-1 differentiation of human pancreatic islet-derived progenitor cells into insulin-producing cells. Endocrinology 2002;143:3152–3161.[Abstract/Free Full Text]

  17. Lechner A, Leech CA, Abraham EJ et al. Nestin-positive progenitor cells derived from adult human pancreatic islets of Langerhans contain side population (SP) cells defined by expression of the ABCG2 (BCRP1) ATP-binding cassette transporter. Biochem Biophys Res Commun 2002;293: 670–674.[CrossRef][Medline]

  18. Selander L, Edlund H. Nestin is expressed in mesenchymal and not epithelial cells of the developing mouse pancreas. Mech Dev 2002;113:189–192.[CrossRef][Medline]

  19. Lardon J, Rooman I, Bouwens L. Nestin expression in pancreatic stellate cells and angiogenic endothelial cells. Histochem Cell Biol 2002;117:535–540.[CrossRef][Medline]

  20. Klein T, Ling Z, Heimberg H et al. Nestin is expressed in vascular endothelial cells in the adult human pancreas. J Histochem Cytochem 2003;51:697–706.[Abstract/Free Full Text]

  21. Humphrey RK, Bucay N, Beattie GM et al. Characterization and isolation of promoter-defined nestin-positive cells from the human fetal pancreas. Diabetes 2003;52:2519–2525.[Abstract/Free Full Text]

  22. Treutelaar MK, Skidmore JM, Dias-Leme CL et al. Nestin-lineage cells contribute to the microvasculature but not endocrine cells of the islet. Diabetes 2003; 52:2503–2512.[Abstract/Free Full Text]

  23. Gao R, Ustinov J, Pulkkinen MA et al. Characterization of endocrine progenitor cells and critical factors for their differentiation in human adult pancreatic cell culture. Diabetes 2003;52:2007–2015.[Abstract/Free Full Text]

  24. Bouwens L, Kloppel G. Islet cell neogenesis in the pancreas. Virchows Arch 1996;427:553–560.[Medline]

  25. Gu G, Dubauskaite J, Melton DA. Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 2002;129: 2447–2457.[Medline]

  26. Dor Y, Brown J, Martinez OI et al. Adult pancreatic beta-cells are formed by self-duplication rather than stem-cell differentiation. Nature 2004;429:41–46.[CrossRef][Medline]

  27. Edlund H. Factors controlling pancreatic cell differentiation and function. Diabetologia 2001;44:1071–1079.[CrossRef][Medline]

  28. Soria B. In-vitro differentiation of pancreatic beta-cells. Differentiation 2001;68:205–219.[CrossRef][Medline]

  29. Lechner A, Habener JF. Stem/progenitor cells derived from adult tissues: potential for the treatment of diabetes mellitus. Am J Physiol Endocrinol Metab 2003;284:E259–E266.[Abstract/Free Full Text]

  30. Gotoh M, Ohzato H, Porter J et al. Crucial role of pancreatic ductal collagenase injection for isolation of pancreatic islets. Horm Metab Res Suppl 1990;25:10–16.[Medline]

  31. Lee SH, Lumelsky N, Studer L et al. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat Biotechnol 2000;18:675–679.[CrossRef][Medline]

  32. Lumelsky N, Blondel O, Laeng P et al. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 2001;292:1389–1394.[Abstract/Free Full Text]

  33. Brustle O, Choudhary K, Karram K et al. Chimeric brains generated by intraventricular transplantation of fetal human brain cells into embryonic rats. Nat Biotechnol 1998;16: 1040–1044.[CrossRef][Medline]

  34. Rajagopal J, Anderson WJ, Kume S et al. Insulin staining of ES cell progeny from insulin uptake. Science 2003;299: 363.[Free Full Text]

  35. Offield MF, Jetton TL, Labosky PA et al. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 1996;122:983–995.[Abstract]

  36. Stoffers DA, Zinkin NT, Stanojevic V et al. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat Genet 1997;15:106–110.[CrossRef][Medline]

  37. Nicholson DW, Thornberry NA. Caspases: killer proteases. Trends Biochem Sci 1997;22:299–306.[CrossRef][Medline]

  38. Eng LF, Ghirnikar RS, Lee YL. Glial fibrillary acidic protein: GFAP-thirty-one years (1969–2000). Neurochem Res 2000;25:1439–1451.[CrossRef][Medline]

  39. Ferreira A, Caceres A. Expression of the class III beta-tubulin isotype in developing neurons in culture. J Neurosci Res 1992;32:516–529.[CrossRef][Medline]

  40. Kim J, Lo L, Dormand E, Anderson DJ. SOX10 maintains multipotency and inhibits neuronal differentiation of neural crest stem cells. Neuron 2003;38:17–31.[CrossRef][Medline]

  41. Keilhauer G, Meier DH, Kuhlmann-Krieg S et al. Astrocytes support incomplete differentiation of an oligodendrocyte precursor cell. EMBO J 1985;4:2499–2504.[Medline]

  42. Thomas LB, Gates MA, Steindler DA. Young neurons from the adult subependymal zone proliferate and migrate along an astrocyte, extracellular matrix-rich pathway. Glia 1996; 17:1–14.[CrossRef][Medline]

  43. Chanas-Sacre G, Thiry M, Pirard S et al. A 295-kDA intermediate filament-associated protein in radial glia and developing muscle cells in vivo and in vitro. Dev Dyn 2000; 219:514–525.[CrossRef][Medline]

  44. Alvarez-Buylla A, Garcia-Verdugo JM, Tramontin AD. A unified hypothesis on the lineage of neural stem cells. Nat Rev Neurosci 2001;2:287–293.[CrossRef][Medline]

  45. Kriegstein AR, Gotz M. Radial glia diversity: a matter of cell fate. Glia 2003;43:37–43.[CrossRef][Medline]

  46. Levitt P, Rakic P. Immunoperoxidase localization of glial fibrillary acidic protein in radial glial cells and astrocytes of the developing rhesus monkey brain. J Comp Neurol 1980; 193:815–840.[CrossRef][Medline]

  47. Sancho-Tello M,Valles S, Montoliu C et al. Developmental pattern of GFAP and vimentin gene expression in rat brain and in radial glial cultures. Glia 1995;15:157–166.[CrossRef][Medline]

  48. Donato R. S100: a multigenic family of calcium-modulated proteins of the EF-hand type with intracellular and extracellular functional roles. Int J Biochem Cell Biol 2001;33: 637–668.[CrossRef][Medline]

  49. Zhou S, Schuetz JD, Bunting KD et al. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med 2001;7:1028–1034.[CrossRef][Medline]

  50. Park IK, Qian D, Kiel M et al. Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells. Nature 2003;423:302–305.[CrossRef][Medline]

  51. Park IK, Morrison SJ, Clarke MF. Bmi1, stem cells, and senescence regulation. J Clin Invest 2004;113:175–179.[CrossRef][Medline]

  52. Scholer HR, Ciesiolka T, Gruss P. A nexus between Oct-4 and E1A: implications for gene regulation in embryonic stem cells. Cell 1991;66:291–304.[CrossRef][Medline]

  53. Chambers I, Colby D, Robertson M et al. Functional expression cloning of nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643–655.[CrossRef][Medline]

  54. Mitsui K, Tokuzawa Y, Itoh H et al. The homeoprotein nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003;113:631–642.[CrossRef][Medline]

  55. Avilion AA, Nicolis SK, Pevny LH et al. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev 2003;17:126–140.[Abstract/Free Full Text]

  56. Hanna LA, Foreman RK, Tarasenko IA et al. Requirement for Foxd3 in maintaining pluripotent cells of the early mouse embryo. Genes Dev 2002;16:2650–2661.[Abstract/Free Full Text]

  57. Wolf C, Thisse C, Stoetzel C et al. The M-twist gene of Mus is expressed in subsets of mesodermal cells and is closely related to the Xenopus X-twi and the Drosophila twist genes. Dev Biol 1991;143:363–373.[CrossRef][Medline]

  58. Nieto MA. The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol 2002;3:155–166.[CrossRef][Medline]

  59. Nieto MA, Sargent MG, Wilkinson DG et al. Control of cell behavior during vertebrate development by Slug, a zinc finger gene. Science 1994;264:835–839.[Abstract/Free Full Text]

  60. Comijn J, Berx G, Vermassen P et al. The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell 2001;7:1267–1278.[CrossRef][Medline]

  61. Bonner-Weir S, Taneja M, Weir GC et al. In vitro cultivation of human islets from expanded ductal tissue. Proc Natl Acad Sci U S A 2000;97:7999–8004.[Abstract/Free Full Text]

  62. Ramiya VK, Maraist M, Arfors KE et al. Reversal of insulin-dependent diabetes using islets generated in vitro from pancreatic stem cells. Nat Med 2000;6:278–282.[CrossRef][Medline]

  63. Otonkoski T, Beattie GM, Rubin JS et al. Hepatocyte growth factor/scatter factor has insulinotropic activity in human fetal pancreatic cells. Diabetes 1994;43:947–953.[Abstract]

  64. Garcia-Ocana A, Vasavada RC, Cebrian A et al. Transgenic overexpression of hepatocyte growth factor in the beta-cell markedly improves islet function and islet transplant outcomes in mice. Diabetes 2001;50:2752–2762.[Abstract/Free Full Text]

  65. Lioubinski O, Muller M, Wegner M et al. Expression of Sox transcription factors in the developing mouse pancreas. Dev Dyn 2003;227:402–408.[CrossRef][Medline]

Received March 3, 2004; accepted for publication May 25, 2004.



This article has been cited by other articles:


Home page
DiabetesHome page
F. Atouf, C. H. Park, K. Pechhold, M. Ta, Y. Choi, and N. L. Lumelsky
No Evidence for Mouse Pancreatic {beta}-Cell Epithelial-Mesenchymal Transition In Vitro
Diabetes, March 1, 2007; 56(3): 699 - 702.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Danner, J. Kajahn, C. Geismann, E. Klink, and C. Kruse
Derivation of oocyte-like cells from a clonal pancreatic stem cell line
Mol. Hum. Reprod., January 1, 2007; 13(1): 11 - 20.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Bauer, L. K. Yu, G. D. Demetri, and J. A. Fletcher
Heat shock protein 90 inhibition in imatinib-resistant gastrointestinal stromal tumor.
Cancer Res., September 15, 2006; 66(18): 9153 - 9161.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. Ta, Y. Choi, F. Atouf, C. H. Park, and N. Lumelsky
The Defined Combination of Growth Factors Controls Generation of Long-Term-Replicating Islet Progenitor-Like Cells from Cultures of Adult Mouse Pancreas
Stem Cells, July 1, 2006; 24(7): 1738 - 1749.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map