Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online August 25, 2005
Stem Cells Vol. 23 No. 10 November 2005, pp. 1468 -1478
doi:10.1634/stemcells.2004-0371; www.StemCells.com
© 2005 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0371v1
2004-0371v2
23/10/1468    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoffman, L. M.
Right arrow Articles by Carpenter, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoffman, L. M.
Right arrow Articles by Carpenter, M. K.

ORIGINAL ARTICLE-CHARACTERIZATION SERIES

X-Inactivation Status Varies in Human Embryonic Stem Cell Lines

Lisa M. Hoffmana, Lisa Hallb, Jennifer L. Battena, Holly Younga, Dheerja Pardasania, E. Edward Baetgec, Jeanne Lawrenceb, Melissa K. Carpentera

a Robarts Research Institute, Krembil Centre for Stem Cell Biology, London, Ontario, Canada;
b Department of Cell Biology, University of Massachusetts Medical School, Worcester, Massachusetts, USA;
c CyThera, Inc., San Diego, California, USA

Key Words. Human embryonic stem cells • Epigenesis • X-chromosome inactivation • Differentiation

Correspondence: Melissa K. Carpenter, Ph.D., CyThera, Inc., 3550 General Atomics Court, San Diego, California 92121, USA. Telephone: 858-455-2736; Fax: 858-455-3962; e-mail: mcarpenter{at}cytheraco.com


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human embryonic stem cells (hESCs) derived from human blastocysts have an apparently unlimited proliferative capacity and can differentiate into ectoderm, mesoderm, and endoderm. As such, hESC lines have enormous potential for use in cell replacement therapies. It must first be demonstrated, however, that hESCs maintain a stable karyotype and phenotype and that gene expression is appropriately regulated. To date, different hESC lines exhibit similar patterns of expression of markers associated with pluripotent cells. However, the evaluation of epigenetic status of hESC lines has only recently been initiated. One example of epigenetic gene regulation is dosage compensation of the X chromosome in mammalian females. This is achieved through an epigenetic event referred to as X-chromosome inactivation (XCI), an event initiated upon cellular differentiation. We provide the first evidence that undifferentiated hESC lines exhibit different patterns of XCI.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Assays for expression of surface markers and transcription factors as well as microarray analyses have indicated that human embryonic stem cell (hESC) lines exhibit similar expression patterns [1, 2]. In the present study, we examined whether various hESC lines are also similar in their epigenetic states and developmental competence. To address this, we evaluated X-chromosome inactivation (XCI), a process that reflects a major embryonic developmental transition. In mammalian females, dosage compensation of the X-chromosome is achieved through XCI, an epigenetic event that is regulated by a single cis-acting X-inactivation center (Xic/XIC in mouse and humans, respectively). XCI is one of the earliest events in mouse development, occurring during preimplantation development. It is developmentally regulated, with initiation of inactivation occurring at the onset of cellular differentiation via upregulation of Xist/XIST expression and coating of the X chromosome selected for inactivation (Xi) [3].

The selection of the X chromosome to be inactivated can be either random or nonrandom (imprinted); this selection is tissue specific, with some tissues exhibiting random XCI and others imprinted XCI. Specifically, in mice, X inactivation is imprinted in the extraembryonic trophectoderm and primitive endoderm lineages during preimplantation development [4]; in these tissues, the maternal allele is expressed whereas the paternal allele is silenced. In contrast, cells of the epiblast randomly inactivate either of the X chromosomes. To date, the developmental regulation of XCI in humans is unclear. Studies have demonstrated that XIST is detectable in oocytes and in both male and female preimplantation embryos up until the blastocyst stage of development [5, 6]. In contrast to the mouse, XIST expression in human extraembryonic trophectoderm is not limited to the paternal allele [7, 8]. However, similar to mouse, epiblast derivatives also exhibit random XCI patterns. In both mouse and humans, once an X chromosome is inactivated, the same X is silenced in all descendent cells; thus, females are mosaic for their X inactivation pattern [9, 10].

Evaluation of the mechanisms involved in the process of XCI has largely been limited to studies in mouse ESCs. The recent availability, however, of hESCs now provides a unique tool to assess this process in early human development. hESCs are derived from human blastocysts, have an apparently unlimited proliferative capacity, differentiate into ectoderm, mesoderm, and endoderm, and may therefore provide a model system for studying early developmental processes. In the present study, we demonstrate the novel finding that individual hESC lines exhibit distinct patterns of X inactivation. Further analysis of XCI may thus be an important mechanism by which to examine epigenetic states and developmental competence in hESC lines, important considerations for use of hESCs as a model of early human development or in cell replacement therapies.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Maintenance of hESC Cultures
H1, H7, and H9 hESC lines from WiCell Research Institute (Madison, WI, http://www.wicell.org) [11] were maintained in feeder-free culture, as previously described [12]. Briefly, hESC cultures were plated onto Matrigel-coated tissue culture plates and maintained in media conditioned by mouse embryonic feeders (MEFs). The base media consisted of knockout Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) supplemented with 20% knockout serum replacement (Invitrogen), 1% nonessential amino acids, 1 mM glutamine, and 0.1 mM ß-mercaptoethanol (ß-ME). Conditioned media was supplemented with 4 ng/ml basic fibroblast growth factor (bFGF) (R&D Systems Inc., Minneapolis, http://www.rndsystems.com) immediately before use. Cultures were passaged after collagenase treatment at a 1:2 or 1:3 ratio upon confluence (after ~5–7 days). BG02 and CyT25 hESCs from CyThera Inc. (San Diego) were grown in DMEM:F12 medium containing 0.1 mM ß-ME, 20% knockout serum replacement, 0.1 mM non-essential amino acids, penicillin/streptomycin (all from Invitrogen), and 4 ng/ml bFGF (R&D Systems). hESCs were cultured on mitomycin C–treated MEFs (Specialty Media, Phillipsburg, NJ, http://www.specialtymedia.com) plated at 20,000 cells per cm2. Cells were passaged manually one time per week. Each vial of hESCs was handled as a separate subclone of the cell line. Different subclones for each hESC line were evaluated as indicated.

Treatment of hESCs with 5-Aza-2'-Deoxycytidine
Upon confluence, H7 and H9 hESCs were passaged into differentiation medium (knockout[KO]-DMEM, 20% fetal bovine serum [FBS], 1% nonessential amino acids, 1 mM glutamine, and 0.1 mM ß-ME) onto Matrigel-coated plates. On days 1 and 2, medium was exchanged with differentiation medium with or without 1, 5, or 10 µM 5-aza-2'-deoxycytidine (cat. #11390; Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), as specified for individual experiments. Cells received either a 24-hour or 48-hour pulse treatment of 5-aza-2'-deoxycytidine, as specified in individual experiments. Cells were collected for analysis on days 3, 7, 14, and 28, as indicated.

Differentiation In Vitro: Formation of Embryoid Bodies
Undifferentiated hESCs were harvested for embryoid body (EB) formation after a 2- to 5-minute incubation in 200 U/ml collagenase at 37°C. hESCs were then resuspended in differentiation medium (KO-DMEM, 20% FBS, 1% nonessential amino acids, 1 mM glutamine, and 0.1 mM ß-ME) and plated on ultralow attachment plates (Corning, Corning, NY, http://www.corning.com). After 4 days in suspension culture, EBs were collected and replated onto gelatin-coated plates (for subsequent RNA isolation) and chamber slides or coverslips (for subsequent immunocytochemistry [ICC] and fluorescence in situ hybridization [FISH] analyses) for the time periods indicated.

Cytogenetic Analysis
Karyotype analysis on each cell line was carried out via g-banding and was conducted at or close to the initiation of each experiment by the Regional Cytogenetics Laboratory, London Health Sciences Center, London, Ontario, Canada (H1, H7, and H9) or at the University of California, San Diego Medical Genetics, Cytogenetic Laboratory, San Diego (BG02 and CyT25). Twenty cells were assessed in each culture tested. Euploid cultures exhibited a normal karyotype in all 20 cells assessed.

Flow Cytometry
Confluent cultures of hESCs were harvested by incubation in collagenase for 3–5 minutes at 37°C and then with versene (GIBCO, Grand Island, NY, http://www.invitrogen.com) for 10–20 minutes at 37°C. The cells were then collected and passed through a 100-µm strainer. All staining was performed in staining buffer (Dulbecco’s phosphate-buffered saline [PBS], Ca2+-free, Mg2+-free) supplemented with 2% heat-inactivated fetal bovine serum (Hyclone, Logan, UT, http://www.hyclone.com). After a 15-minute block at 4°C in staining buffer supplemented with 20% normal goat serum, the cells were incubated in primary antibodies for 30 minutes at 4°C. The following antibodies were used: SSEA-4 (MC813-70) (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA, http://www.uiowa.edu/~dshbwww) at a 1:10 dilution; Tra-1-60 (a gift from Dr. Peter Andrews, University of Sheffield, Sheffield, U.K.) at a 1:60 dilution, Tra-1-81 (a gift from Dr. Peter Andrews) at a 1:80 dilution, and SSEA-1 (MC-480) (Developmental Studies Hybridoma Bank) at a 1:40 dilution, as well as appropriate isotype-matched controls (100 µl per test; 5 x 105 cells per sample). Cells were subsequently washed two to three times with staining buffer and incubated for 30 minutes at 4 °C with fluoresce in isothiocyanate–conjugated goat F(ab')2 anti-mouse IgG3, 1:100 and phycoerythrin-conjugated goat F(ab')2 anti-mouse IgM, 1:100 (Southern Biotechnology Associates, Birmingham, AL, http://www.southernbiotech.com) as appropriate. Cells were washed once again and resuspended for analysis in staining buffer containing 7-AAD (5 µl per 1 x 106 cells) to identify nonviable cells. Flow cytometric analysis was performed with the FACSCalibur Flow Cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com). Acquired data were analyzed with FlowJo software.

Immunofluorescence and In Situ Hybridization

Cell Preparation   Cell fixation and preparation was performed in a similar fashion as described by Lawrence et al. [13]. Briefly, cells were plated on either chamber slides or coverslips and rinsed sequentially with the following: x 1 PBS, cytoskeletal (CSK) buffer (100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, and 10 mM PIPES, pH 6.8) for 30 seconds on ice, CSK buffer plus 0.5% Triton X-100 (Sigma-Aldrich) for another 30 seconds on ice, and then CSK buffer alone. The cells were fixed in 4% paraformaldehyde for 10 minutes at room temperature and stored at 4°C in PBS/Tween (0.2%) for subsequent ICC analysis and in 70% EtOH for subsequent FISH analysis.

Immunofluorescence   At 37°C and in a humidity chamber, the cells prepared as above were first blocked with blocking buffer (x 1 PBS, 5% goat serum, and 0.2% Tween) for 30 minutes, after which cells were incubated with primary antibodies for 1 hour. The primary antibodies used were anti-histone MacroH2A1 (Upstate, Waltham, MA, http://www.upstate.com) 1:200; SSEA-4 (MC813-70) (Developmental Studies Hybridoma Bank) 1:20; anti-human {alpha}-fetoprotein, clone C3 (Sigma-Aldrich) 1:500; anti–{alpha} smooth muscle actin (Sigma-Aldrich) 1:400; anti-neuronal class III ß-tubulin (Covance, Princeton, NJ, http://www.covance.com) 1:500; Oct-4 (N-19) (Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com) 1:80, and Tra-1-60(agift from Dr. Peter Andrews) 1:100. The cells were subsequently washed with PBS/Tween (0.2%) and again at 37°C in a humidity chamber, blocked for another 5 minutes in blocking buffer, and incubated for 30 minutes with the following appropriate secondary antibodies at 1:200 dilutions: Alexa Fluor goat anti-mouse 594 IgG; Alexa Fluor goat anti-rabbit 488 IgG; Alexa Fluor rabbit anti-goat IgG (Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com); and goat anti-mouse IgM (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com). The cells were then rinsed with PBS/Tween (0.2%), counterstained with 4,6-diamidino-2-phenylindole (DAPI) (1 µg/ml in PBS), and mounted with Vectashield (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com). When conducting double immuno-RNA FISH for simultaneous detection of OCT3/4 and XIST RNA, detection of XIST (via the antidigoxigenin-fluorescein Fab) and incubation with the OCT-4 primary antibody were done concurrently. Detection of OCT-4 via the Alexa Fluor rabbit anti-goat 594 secondary antibody was conducted after appropriate rinses.

RNA and DNA Fluorescence In Situ Hybridization

Probes   DNA probes used were a 10-kb human genomic XIST gene construct (XIST plasmid G1A) [14] and human Cot-1 DNA (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) [15]. The DNA probes (1 µg per reaction) were nick-translated using digoxigenin-16-dUTP (Roche Diagnostics) or synthesized using DIG-Nick Translation Mix following the manufacturer’s instructions (Roche Diagnostics).

In Situ Hybridization and Detection   Hybridization and detection were performed as previously described [16, 17]. Briefly, cells were hybridized under nondenaturing conditions overnight at 37°C in 50% formamide/x2 standard saline citrate (SSC) using a probe concentration of approximately 5 µg/ml. Mouse Cot-1 DNA was incubated in the hybridization buffer for the hybridization. Posthybridization washes were performed as follows: 50% formamide/x4 SSC for 20 minutes at 37°C, x2 SSC for 20 minutes at 37°C, x1 SSC for 20 minutes at room temperature, and x 4 SSC for 1 minute at room temperature. Signal was subsequently detected after a 1-hour incubation at 37°C with anti-digoxigenin fluorescein (Roche Diagnostics), diluted 1:500 in x 4 SSC/1% bovine serum albumin. Postdetection washes were as follows: x 4 SSC for 10 minutes at room temperature in the dark with agitation (twice), incubation with DAPI (1 µg/ml in PBS) for 5 minutes at room temperature in the dark with agitation, and a rinse with x 1 PBS. Slides were mounted with vectashield (Vector Laboratories). Whole chromosome detection was performed as described [16]. An X-chromosome library hybridization (biotinylated X-chromosome paint from Oncor, Gaithersburg, MD) in conjunction with XIST RNA detection was used. Protocols for DNA and/or RNA FISH have been previously described in detail [17]. Posthybridization washes, detection, and postdetection washes were performed as described above.

Real-Time and Reverse Transcription–Polymerase Chain Reaction
Total RNA was isolated from 0-day (undifferentiated cells) and 7- and 14-day EBs (differentiated cells) using RNeasy kits (Qiagen, Hilden, Germany, http://www1.qiagen.com). Briefly, cells were lysed in 600 µl/well (six-well plate) RLT buffer containing 10 µl/ml ß-ME and subsequently homogenized by filtration through a QIAshredder. One volume of 70% ethanol was then added to the homogenate, and the sample was applied to an RNeasy mini column. On-column DNase digestion was carried out during the isolation using an RNase-Free DNase Set (Qiagen). After a series of washes, RNA was eluted in RNase-free water. First-strand cDNA synthesis was subsequently carried out using approximately 1 µg of total RNA and Superscript II reverse transcription, following the manufacturer’s instructions (Invitrogen). Polymerase chain reaction (PCR) mixtures were prepared as described (Invitrogen); final MgCl2, dTNP, and oligonucleotide concentrations used were 1.5 mM, 200 µM, and 200 nM, respectively. Amplification parameters were as follows: 1 cycle at 94°C for 2 minutes; 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; and 1 cycle at 72°C for 10 minutes. Quantitative real-time PCR was performed using a Stratagene Mx4000 and a Brilliant Cyber Green qPCR Core Reagent Kit (Stratagene, La Jolla, CA, http://www.stratagene.com) following the manufacturer’s instructions. Briefly, 1.5 mM MgCl2, 800 µM dNTPs, 200 nM oligonucleotide primers, 8% glycerol, 5% dimethylsulfoxide, 20 nM reference dye, and x 0.5 SYBR green dye were used in reaction mixtures. Samples were normalized against GAPDH. Primer sequences were as follows: XIST 5', agctcctcggacagctgtaa; XIST 3', ctccagatagctggcaacc; OCT3/4 5', cttgctgcagaagtgggtggaggaa; OCT3/4 3', ctgcagtgtgggtttcgggca; CRIPTO 5', acagaacctgctgcctgaat; CRIPTO 3', atcacagccgggtagaaatg; REX-1 5', tgaaagcccacatcctaacg; REX-1 3', caagctatcctcctgctttgg; NANOG 5', caaaggcaaacaacccactt; NANOG 3', tctgctggaggctgaggtat; STAT3 5', tttcacttgggtggagaagg; STAT3 3', ggctacctgggtcagcttcag; UTF-1 5', accagctgctgaccttgaac; UTF-1 3', ttgaacgtacccaagaacga; GAPDH 5', gagtcaacggatttggtcgt; GAPDH 3', ttgattttggagggatctcg.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Individual hESC Lines Exhibit Distinct Patterns of X-Chromosome Inactivation
Evaluation of the mechanisms involved in the process of XCI have largely been limited to studies in mouse ESCs [1821]. These studies demonstrate that before X-inactivation, a small spot or "transcription focus" of Xist is expressed from both X chromosomes in undifferentiated female ESCs and also from the single X chromosome in male ESCs. At the onset of cellular differentiation, however, Xist expression is upregulated on one of the two chromosomes in the female, thereby creating a much larger accumulation that coats the X chromosome that is to be inactivated. Xist expression on the remaining active X chromosome (or the single X in the male) is silenced [22, 23].

To assess the status of XCI in hESCs, we first analyzed XIST expression in undifferentiated male (H1 and BG02) and female (H7, H9, and CyT25) hESC lines, all of which exhibited a normal karyotype as assessed via g-banding (data not shown). In these experiments, H1, H7, and H9 hESCs were maintained in feeder-free conditions, whereas the BG02 and CyT25 lines were maintained on MEFs, as described in Materials and Methods. Each cell line expressed standard markers of undifferentiated hESCs, including SSEA-4, TRA-1-60, CRIPTO, REX-1, OCT3/4, NANOG, STAT3, and UTF-1 (Figs. 1AGo, 2Ai, 2AiiGo). Quantitative PCR (Fig. 1BGo) and flow cytometry analysis (Table 1Go) similarly demonstrate expression of characteristic stem cell markers in each of the hESC lines used in this study.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. (A): RT-PCR demonstrates the expression of several markers and transcription factors characteristic of H1 (P50), H7 (P34), H9 (P51), CyT25 (P60), and BG02 (P31) hESCs. (B): qPCR demonstrates that upon differentiation, expression of OCT3/4 and Nanog decreases in all hESC cultures assessed (H9, CyT25, H7, H1, and BG02). One sample of H9 undifferentiated cells was used as the calibrator for analysis of OCT3/4 and Nanog expression. Each bar represents duplicate samples. (C): Left panel: RT-PCR demonstrates expression of XIST in control cultures of differentiated female IMR fibroblasts and in H9 (P42) and CyT25 (P60) undifferentiated hESCs and EBs differentiated for 14 and 9 days, respectively. Expression of XIST is not observed in H1 (P63), H7 (P45), and BG02 (P31) undifferentiated hESCs and EBs differentiated for 14 (H1 and H7) or 9 (BG02) days. Right panel: XIST expression is maintained in H9 hESCs after extended passage. Four samples of low- and high-passage cultures (as indicated) from three separate subclones are shown, (D): qPCR demonstrates that in comparison with expression of OCT3/4, XIST expression is detected in cultures of undifferentiated H9 and CyT25 hESCs but not in cultures of undifferentiated H1, H7, and BG02 hESCs. Upon differentiation, XIST expression does not increase in H9 and CyT25 EB cultures and remains undetectable in cultures of H1, H7, and BG02 EBs. One sample of H9-undifferentiated cells was used as the calibrator for analysis of OCT3/4 expression and IMR female fibroblasts for analysis of XIST expression. n = 2 for H1, H7, and H9 hESC and EB cultures, SEM ≤ 0.1 (OCT3/4) and < 0.2 (XIST); n = 3 for CyT25 and BG02 cultures, SEM = 0.1; n = 1 for IMR fibroblasts. Abbreviations: Dif, differentiated hESCs/EBs; EB, embryoid body; hESC, human embryonic stem cell; qPCR, quantitative polymerase chain reaction; RT-PCR, reverse transcription–polymerase chain reaction; UD, undifferentiated hESCs.

 


View larger version (48K):
[in this window]
[in a new window]
 
Figure 2. (A): Immunocytochemical analysis of H9 (P70) cultures shows positive staining for (i) TRA-1-60 and (ii) SSEA-4 in a typical undifferentiated hESC colony. (iii): Fluorescence in situ hybridization analysis demonstrates accumulation of XIST RNA (territory) in H9 (P38) hESC cultures, x 60 magnification, but not in (iv) H7 (P40) hESC cultures, x 60 magnification. (v): Expression of XIST in OCT3/4-positive (red) cells in H9 (P74) cultures. (vi): Detection of two XIST signals in undifferentiated XXX H9 (P69) cultures. X-chromosome paint analysis (in green) demonstrates the presence of two X chromosomes in both (vii) H9 (P45) and (viii) H7 (P48) cultures, x 100 magnification. An inactivated X chromosome is indicated by the box in panel vii, with individual channels shown to the right of the panel: Colocalization of XIST transcripts (in red) with an X chromosome (in green) is demonstrated in H9 cells. Cells are counterstained with 4,6-diamidino-2-phenylindole (in blue). (B): Reverse transcription–polymerase chain reaction demonstrates that in control H7 hESC (UD) cultures, expression of XIST transcripts is undetectable. After treatment with 5-aza-2'-deoxycytidine, (1 and 10 µM), however, XIST expression is detected in H7 hESCs at days 3, 14, and 28 after treatment, as in parallel control IMR female fibroblasts. Abbreviation: hESC, human embryonic stem cell.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Flow cytometry analysis demonstrates expression of SSEA-4, TRA-1-60, and TRA-1-81 in undifferentiated H1, H7, and H9 human embryonic stem cells
 
XIST expression is virtually undetectable in undifferentiated male hESC cultures. The female hESC lines, in comparison, exhibit distinct differences in XIST expression; XIST expression is relatively strong in undifferentiated H9 and CyT25 cultures and is similar to levels of expression found in human female fibroblasts (Figs. 1C, 1DGo). Expression of XIST transcripts, however, is undetectable by PCR in female H7 hESCs (Figs. 1C, 1DGo). Chromosome paint analysis confirms that two separate X-chromosome territories are apparent in approximately 80% of cultured H7 and H9 hESCs (Figs. 2Avii, 2AviiiGo; Table 2Go). Two separate X-chromosomes are not observed in 100% of the interphase cells due to the proximity of the two X-territories and the limitations of two-dimensional scoring; this is not indicative of aneuploidy because karyotype analysis of mitotic chromosomes reveals two X chromosomes in all cells assessed.


View this table:
[in this window]
[in a new window]
 
Table 2. Quantitation of the number of cells with detectable XIST accumulation on one X chromosome and the number of X chromosomes (territories) found in H9 hESCs, H7 hESCs and TIG-1 female fibroblasts
 
FISH analysis clearly demonstrates a large XIST RNA accumulation that paints one X chromosome in approximately 90% of H9 hESCs (Fig. 2AiiiGo, Table 2Go), notably in both OCT3/4-positive, Tra1-60–positive, and SSEA-4–positive undifferentiated cells with in the colonies and in differentiated cells at the periphery of the hESC colonies (Figs. 2Ai, 2Aii, 2Aiii, 2AvGo). These numbers are comparable to those scored for normal female fibroblasts (Table 2Go), indicating that undifferentiated H9 hESC cultures exhibit XCI patterns similar to those observed in normal female somatic cells. This is further demonstrated by the fact that both undifferentiated (blue and arrows in DAPI DNA image, Fig. 3AGo) as well as differentiated (Fig. 3BGo) H9 hESC cells exhibit clear heterochromatic Barr bodies by DAPI DNA. In contrast, there is a clear lack of XIST accumulation on either of the chromosomes in H7 hESCs (Figs. 2Aiv, 2AviiiGo, 3CGo; Table 2Go). In some rare undifferentiated H7 cells, there seems to be a very small spot of XIST RNA that is reminiscent of the small unstable transcription observed to occur in mouse ESCs (not shown); however, this could not be rigorously discriminated from background. Regardless, there is no definitive evidence that XIST expression is ever upregulated in this line or accumulates on either X chromosome during differentiation, suggesting that, in contrast to H9 and CyT25 female hESCs, H7 hESCs fail to initiate classic XCI.



View larger version (76K):
[in this window]
[in a new window]
 
Figure 3. (A): As evidenced in the separated color channels to the right of the full color image, a field of undifferentiated H9 (P45) hESCs clearly shows an inactivated X chromosome (Xi), which is painted by XIST RNA (red and XIST RNA image) and exhibits a DAPI dense heterochromatic Barr body (blue and arrows in DAPI DNA image). Hybridization to hnRNA (green) using the Cot-1 probe demonstrates transcriptional silencing by the apparent hole in the signal (arrows in Cot-1 RNA image) over the Barr body. (B): Differentiated H9 hESCs (14-day embryoid bodies) maintain the inactivation of the Xi, which is still painted by XIST RNA (red and XIST RNA image) and exhibits a heterochromatic Barr body (arrow in DAPI DNA image). The apparent hole in the hnRNA signal (arrow in Cot-1 RNA image) over the Barr body suggests continued silencing. (C): The female H7 (P73) hESC line does not exhibit these unmistakable hallmarks of inactivation in either of its two X chromosomes by day 14 of differentiation. Two X chromosome centromeres (red and X-centromere image) are apparent, but neither one is associated with an obvious Barr body (blue and arrows in DAPI DNA image) or Cot-1 hnRNA hole (green and arrows in Cot-1 RNA image). Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; hESC, human embryonic stem cell; hnRNA, heterogeneous nuclear RNA.

 
Chromosome-Wide Xi Transcriptional Silencing Is Apparent in H9 hESCs but Not in H7 hESCs
The above data suggest that in H9-undifferentiated hESCs, one of the two X chromosomes is inactivated whereas the H7 hESC line never initiates XCI nor inactivates one of its two X chromosomes. To verify this, we evaluated the transcriptional status of the X chromosomes in both H9 and H7 hESCs by hybridization to heterogeneous nuclear RNA (hnRNA) transcription in the nucleus. Briefly, by using a labeled human Cot-1 DNA probe and RNA FISH, we can visualize hnRNA transcription throughout the nucleus; this assay allows direct assessment of global transcription across the entire X chromosome rather than relying on replication timing or expression of just a few individual genes [15] and has become widely used as a method to evaluate chromosome silencing [24, 25]. H9 hESCs clearly show a lack of hnRNA transcription signal, creating a large "black hole" under the XIST RNA accumulation that is coincident with the heterochromatic Barr body and clearly indicative of transcriptional silencing. This is seen in both undifferentiated and differentiated H9 hESCs (Figs. 3A, 3BGo).

H7 hESCs, in contrast, never accumulate XIST RNA (Figs. 2AivGo, 3CGo), and as such, we could not use XIST to localize the Xi in these cells. Rather, an X-specific centromere signal (Fig. 3CGo) delineates both X chromosomes in the H7 line, allowing us to assess whether these reside within a chromosome-size territory lacking in Cot-1/hnRNA hybridization. In addition, neither of the two X chromosomes in H7 hESCs (Fig. 2AviiiGo) exhibits a large clear hole in the hnRNA signal (Fig. 3CGo), suggesting a lack of chromosome-wide silencing in this line, even after differentiation. Although technical limitations do not allow us to conclude that all genes on both X chromosomes remain active, results clearly indicate that the H7 hESCs do not show the chromosome-wide transcriptional silencing that is readily apparent in both H9 hESCs or normal control cells. Consistent with this, the DAPI-dense Barr bodies easily identified in the H9 cells are lacking in the H7 cells (Fig. 3CGo). Together, these findings demonstrate that H7 hESCs lack clear hallmarks of chromosomal silencing in both the undifferentiated state and in cells 14 days after differentiation.

Differences in XCI Do Not Correlate with Differences in Gross hESC Expression Profiles
Despite differences in XCI between the H7 and H9 and CyT25 hESC lines, expression of several molecular markers that are characteristic of hESCs is appropriate and comparable between cell lines. Specifically, we demonstrate via reverse transcription (RT)-PCR that expression of CRIPTO, REX-1, OCT3/4, NANOG, STAT3, and UTF-1 does not vary between undifferentiated H1, H7, H9, CyT25, and BG02 hESC lines (Fig. 1AGo). Quantitative PCR and flow cytometry analyses further demonstrate the expression of OCT3/4, NANOG, and SSEA-4, Tra-1-60, and Tra-1-81, respectively, in each of these lines (Figs. 1B, 1DGo; Table 1Go), indicating that differences in the pattern of XCI do not correlate with changes in expression of characteristic stem cell markers.

Macrochromatin Body Formation in Differentiated hESCs
We next evaluated whether downstream components of the X-inactivation process are expressed appropriately in various hESC lines. In differentiating mouse ESCs, an accumulation of MacroH2A1 and the formation of macrochromatin bodies (MCBs) occur at 5 days of differentiation, subsequent to the upregulation in Xist expression and coating of the X chromosome at 1 day of differentiation [2628]. Therefore, we assessed MCBs using immunocytochemical localization of MacroH2A1.

In undifferentiated H9 hESC cultures maintained in feeder-free conditions, MCBs are evident in nuclei of differentiating cells surrounding hESC colonies but are absent in the nuclei of cells within hESC colonies that express SSEA-4 (Figs. 4Ai, 4Aii, 4AiiiGo). Therefore, the undifferentiated cells in these cultures exhibit XIST coating of the X chromosome but not MCB formation, demonstrating that the H9 hESCs may be in between these two developmental stages. Our observation that the differentiated cells outside of the colonies exhibit MCBs further indicates that the process of XCI is appropriately temporally regulated in cultures of H9 hESCs (see below). In contrast, MCBs are not evident during differentiation in either male H1 (data not shown) or female H7 (Figs. 4Aiv, 4Av, 4AviGo) hESC cultures, confirming a lack of XCI in both cell lines.



View larger version (75K):
[in this window]
[in a new window]
 
Figure 4. (A): (i): SSEA-4-positive (in red) H9 (P37) hESCs counterstained with DAPI (in blue). (ii): Costaining of MacroH2A1 <AU9>(in green) with SSEA-4 in H9 hESCs. (iii): H9 hESCs stained with SSEA-4, MacroH2A1, and DAPI. (iv): SSEA-4-positive (in red) H7 (P54) hESCs counterstained with DAPI (in blue). (v): Lack of MacroH2A1 expression (in green) in SSEA-4–positive H7 hESCs. (vi): H7 hESCs stained with SSEA-4, MacroH2A1, and DAPI; x 40 magnification for (i)-(vi). (vii): Costaining of MacroH2A1 with ß-tubulin in 175-day-differentiated H9 neural progenitors; x 40 magnification. Costaining of MacroH2A1 with {alpha}-smooth muscle actin, x 40 magnification (viii), and {alpha}-fetoprotein (AFP), x 40 magnification (ix), in 7- to 14-day H9 (P37) EB cultures. Boxes indicate accumulation of MacroH2A1 and the presence of macro-chromatin bodies. Lack of MacroH2A1 staining with (x) ß-tubulin, x 40 magnification, (xi) {alpha}-smooth muscle actin, x 40 magnification, and (xii) AFP, x 40 magnification in 7- to 14-day H7 (P71-73) EB cultures. (B): Demonstration that the number of H9 (P37, P42, P45) hESCs expressing MacroH2A1 increases upon differentiation whereas the number of cells expressing XIST remains the same. The values in parentheses indicate the number of samples counted for MacroH2A1 and XIST, respectively, as well as the number of individual experiments conducted. Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; EB, embryoid body; hESC, human embryonic stem cell.

 
Patterns of X-Inactivation Are Heritable to Differentiated Progeny
To further assess whether XCI in female hESCs is coincident with cellular differentiation, EBs were generated and temporal changes in gene expression were analyzed. We demonstrate that an appropriate decrease in expression of OCT3/4 is observed upon in vitro differentiation of all lines tested (Figs. 1B, 1DGo). Expression of XIST transcripts, however, persists in EB cultures of H9 and CyT25 hESCs (Figs. 1C, 1DGo) and in H9-derived neural progenitor cultures (113 days of differentiation; data not shown). XIST expression did not increase with differentiation (Figs. 1C, 1DGo, 4BGo), confirming that XCI was complete in the undifferentiated cultures.

The percentage of hESCs exhibiting an accumulation of MCBs, in comparison, increases upon differentiation (Fig. 4BGo). Moreover, MCBs are detectable in ectoderm, endoderm, and mesoderm derivatives of H9 hESCs; colocalization of MacroH2A1 with ß-tubulin is identifiable in 175-day-differentiated H9 neural progenitors (Fig. 4AviiGo) and with smooth muscle actin (Fig. 4AviiiGo) and {alpha}-fetoprotein (Fig. 4AixGo) after 7 to 14 days of hESC differentiation, providing further evidence that these female hESCs are differentiating appropriately and that X-inactivation progresses throughout in vitro differentiation. In contrast, there is a lack of expression of XIST transcripts (Figs. 1C, 1DGo, 2AivGo, 3CGo) and MacroH2A1 accumulation (Figs. 4Ax, 4Axi, 4AxiiGo) in H7 hESC and EB cultures and in H7-derived neural progenitor cultures (37 days of differentiation; data not shown), providing strong evidence of a lack of classic XCI in this female hESC line.

XCI Occurs Appropriately in an Aneuploid H9 hESC Line
Supernumerary X chromosomes are tolerated in human cells when the extra X chromosomes are inactivated [29]. For instance, XXY or XXXY cells will exhibit XIST coating of one or two X-chromosomes, respectively. We have generated an H9 hESC subclone in which g-banding reveals that 5% of the cells within the culture have an XXX genotype. In these cultures, we observe patches of cells showing 2 XIST signals (Fig. 2AviGo); quantitation reveals that 12% ± 7% (mean ± SEM) of the cells in the culture exhibit two XIST signals. These data indicate that although this H9 subclone has an aneuploid karyotype, mechanisms are maintained for the appropriate dosage compensation of the X chromosome.

XCI Is Stable over Time In Vitro
Numerous hESC lines have now been derived, and despite differences in the derivation process and culture conditions, evaluation of standard markers, telomerase activity, pluripotency, and karyotype indicates that hESC lines are stable over extended periods of culture (see Hoffman and Carpenter for review [30]). In this study, we demonstrate that after more than 80 passages (20 months) in continuous culture, H9 hESCs also retain appropriate expression of XIST transcripts (Fig. 1CGo, right panel).

Expression of XIST Is Modulated After Treatment with 5-Aza-2'-Deoxycytidine
5-Aza-2'-deoxycytidine is a well-known demethylating agent that is widely used to demonstrate a correlation between loss of methylation in specific regions of a gene and activation of gene activity. Here, we demonstrate via RT-PCR that after treatment with 5-aza-2'-deoxycytidine, XIST expression is detected in H7 hESCs (Fig. 2BGo, Table 3Go). In these experiments, H7 hESCs were treated with 1 or 10 µM 5-aza-2'-deoxycytidine for 24 or 48 hours, and expression of XIST and OCT3/4 was assessed 3, 14, and 28 days after treatment. Treatment with 5-aza-2'-deoxycytidine resulted in differentiation as indicated by the decrease in OCT3/4 expression. This was accompanied by the appearance of XIST expression by 3 days after treatment. The expression of XIST persisted for 28 days, the latest time point analyzed. However, the detection of XIST by PCR was not accompanied by Xist coating of an X chromosome, as assessed via FISH analysis (data not shown), indicating a continued lack of XCI in H7 hESCs.


View this table:
[in this window]
[in a new window]
 
Table 3. Different subclones of H7 human embryonic stem cells at various passage numbers
 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inactivation of one X chromosome in females occurs during early human development and generally occurs in a random manner in epiblast derivatives, such that most females will have some cells with a maternally derived inactive X chromosome (Xi) and some with a paternally derived Xi [31]. In the present study, we demonstrate that various female hESC lines exhibit distinct patterns of XCI. Specifically, we demonstrate that XIST is expressed, coats, and transcriptionally silences the X chromosome in undifferentiated H9 hESCs (Figs. 1C, 1DGo, 2Aiii, 2Av, 2AviiGo). Cot-1 analysis assessing global transcription across the entire X chromosome further demonstrates that inactivation of one of the two active X chromosomes has occurred (Fig. 3AGo). Although FISH analyses of XIST and Cot-1 could not be conducted on CyT25 hESCs, RT-PCR and quantitative PCR data suggest that XCI also occurs in undifferentiated CyT25 hESCs (Figs. 1C, 1DGo). The finding that XCI is occurring in undifferentiated hESCs is novel and indicates that the cells have either undergone inactivation before their isolation or before our evaluating the H9 cell line from WiCell or the CyT25 cell line from CyThera Inc. Because the hESCs already exhibit XCI, we do not observe an increase in XIST expression upon differentiation (Fig. 4BGo). Increased expression of MacroH2A1 upon differentiation of H9 cell cultures (Fig. 4BGo), however, suggests that our undifferentiated H9 cells are in a state of differentiation that lies somewhere between the coating of the chromosome by XIST RNA and the formation of MCBs, indicating that XCI events after XIST localization during cellular differentiation are progressing in a manner consistent with reports of XCI in vivo [2628].

Studies in mouse ESCs demonstrate expression of Xist from both X chromosomes in undifferentiated female ESCs. At the onset of cellular differentiation, however, Xist expression is upregulated on one of the two chromosomes while being silenced on the remaining X chromosome [22, 23]. Although our findings contrast with those in mouse ESCs, it is not particularly surprising given reports that clearly indicate differences between the two [32, 33]. It is also important to recognize that numerous hESC lines have now been derived, and although they express markers typical of ESCs, including SSEA-4, OCT3/4, Tra-160, and NANOG, many of these cell lines differ in the manner in which they were derived and maintained in culture [30]. Such differences may have significant effects on the characteristics of the resultant cell lines and may also contribute to differences in the regulation of developmental events occurring at the time of derivation, such as XCI.

Indeed, variability between hESC lines and even between subclones of various lines may also account for the difference in findings between our study and that of Dhara and Benvenisty [34], who report that both X chromosomes are active in undifferentiated H9 hESC cultures. Our finding that both H9 and CyT25 female cell lines exhibit XCI, despite differences in the manner in which each of these cell lines was maintained, i.e., feeder-free conditions versus culture on mitomycin C MEFs, respectively, suggests that variations in culture conditions are not primarily responsible for the differences in XCI. In addition, both the H7 and H9 lines were derived in the same laboratory, acquired from WiCell, and maintained in feeder-free conditions in our laboratory, yet these lines show different patterns of XCI. Furthermore, although systematic evaluations are still ongoing, we have not observed changes or loss of XCI in high-passage cultures (Fig. 1CGo). As such, it is possible that differences in epigenetic status between hESC lines may reflect variability in embryo quality or grade, age of the embryo, or derivation techniques. One cannot discount the possibility, however, that differences between various hESC lines may have occurred simply as a result of clonal issues and low viability of cells thawed from primary vials. Regardless, although each of these hESC lines appears phenotypically stable in its expression of markers, expression of telomerase, ability to differentiate (pluripotency), and maintenance of a stable karyotype, we provide evidence that various hESC lines, and even subclones of the same line, exhibit distinct differences in status of XCI. Indeed, even after more than 1 month of differentiation, we did not observe detectable levels of XIST mRNA, transcriptional silencing, or XIST or MacroH2A1 accumulation in H7 hESCs. Although this line failed to undergo appropriate XCI in this study, H9hESCs exhibit temporal patterns of XCI consistent with in vivo studies [2628]. Furthermore, our findings that XXX H9 hESCs exhibit two inactivated X chromosomes suggest that the mechanism of XCI is appropriate in this line (Fig. 1AviGo). Again, we emphasize the demonstration that, despite significant differences in XCI between the H7 and H9 cell lines, expression of several markers characteristic of hESCs is appropriate between cell lines (Fig. 1AGo). Thus, the observed differences in XCI do not seem to be due to differences in gross hESC expression profiles. As such, it will be important to fully characterize the pluripotent state in various human cell types and to further assess whether such observed differences in XCI correlate with differences in the developmental states or competence of various hESC lines. It will also be important to elucidate the molecular mechanisms by which epigenetic states may become altered upon prolonged culture and cellular differentiation. Specifically, assessing whether there is a loss of imprinting or otherwise inappropriate gene expression upon cell differentiation will have critical implications for the derivation of new hESC lines and for their use in cell replacement therapies.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We thank Meg Byron for her excellent technical assistance with molecular cytology experiments. We thank Dmitri Nusinow and Barbara Panning for technical assistance and insightful discussions. This work was supported in part by the Krembil Foundation and an establishment grant from the Canadian Institutes of Health Research awarded to M.K.C.; an NIH RO1 supplemental grant (GM053234-07S1) awarded to J.L.; and a postdoctoral fellowship from the Ontario Research and Development Challenge Fund awarded to L.M.H. The Lawrence laboratory component of this work involved the H9, H7, and H1 hESC cells approved for NIH funding and no other cell lines (CyT25) that are not currently NIH approved.

DISCLOSURES
The authors indicate no potential conflicts of interest.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bhattacharya B, Miura T, Brandenberger R et al. Gene expression in human embryonic stem cell lines: unique molecular signature. Blood 2004;103:2956–2964.[Abstract/Free Full Text]

  2. Carpenter MK, Rosler ES, Fisk GJ et al. Properties of four human embryonic stem cell lines maintained in a feeder-free culture system. Dev Dyn 2004;229:243–258.[CrossRef][Medline]

  3. Monk M, Harper MI. Sequential X chromosome inactivation coupled with cellular differentiation in early mouse embryos. Nature 1979;281: 311–313.[CrossRef][Medline]

  4. Takagi N, Sasaki M. Preferential inactivation of the paternally derived X chromosome in the extraembryonic membranes of the mouse. Nature 1975;256:640–642.[CrossRef][Medline]

  5. Daniels R, Zuccotti M, Kinis T et al. XIST expression in human oocytes and preimplantation embryos. Am J Hum Genet 1997;61:33–39.[Medline]

  6. Ray PF, Winston RM, Handyside AH. XIST expression from the maternal X chromosome in human male preimplantation embryos at the blastocyst stage. Hum Mol Genet 1997;6:1323–1327.[Abstract/Free Full Text]

  7. Harrison KB. X-chromosome inactivation in the human cytotrophoblast. Cytogenet Cell Genet 1989;52:37–41.[Medline]

  8. Ropers HH, Wolff G, Hitzeroth HW. Preferential X inactivation in human placenta membranes: is the paternal X inactive in early embryonic development of female mammals? Hum Genet 1978;43:265–273.[CrossRef][Medline]

  9. Plath K, Mlynarczyk-Evans S, Nusinow DA et al. Xist RNA and the mechanism of X chromosome inactivation. Annu Rev Genet 2002;36: 233–278.[CrossRef][Medline]

  10. Heard E, Clerc P, Avner P. X-chromosome inactivation in mammals. Annu Rev Genet 1997;31:571–610.[CrossRef][Medline]

  11. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  12. Xu C, Inokuma MS, Denham J et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol 2001;19:971–974.[CrossRef][Medline]

  13. Lawrence JB, Singer RH, Marselle LM. Highly localized tracks of specific transcripts within interphase nuclei visualized by in situ hybridization. Cell 1989;57:493–502.[CrossRef][Medline]

  14. Clemson CM, Chow JC, Brown CJ et al. Stabilization and localization of XIST RNA are controlled by separate mechanisms and are not sufficient for X inactivation. J Cell Biol 1998;142:13–23.[Abstract/Free Full Text]

  15. Hall LL, Byron M, Sakai K et al. An ectopic human XIST gene can induce chromosome inactivation in postdifferentiation human HT-1080 cells. Proc Natl Acad Sci U S A 2002;99:8677–8682.[Abstract/Free Full Text]

  16. Clemson CM, McNeil JA, Willard HF et al. Xist RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J Cell Biol 1996;132:259–275.[Abstract/Free Full Text]

  17. Johnson CV, Singer RH, Lawrence JB. Fluorescent detection of nuclear RNA and DNA: implications for genome organization. Methods Cell Biol 1991;35:73–99.[Medline]

  18. Lee JT, Strauss WM, Dausman JA et al. A 450 kb transgene displays properties of the mammalian X-inactivation center. Cell 1996;86:83–94.[CrossRef][Medline]

  19. Panning B, Jaenisch R. DNA hypomethylation can activate XIST expression and silence x-linked genes. Genes Dev 1996;10:1991–2002.[Abstract/Free Full Text]

  20. Penny GD, Kay GF, Sheardown SA et al. Requirement for XIST in X chromosome inactivation. Nature 1996;379:131–137.[CrossRef][Medline]

  21. Clerc P, Avner P. Role of the region 3' to XIST exon 6 in the counting process of X-chromosome inactivation. Nat Genet 1998;19:249–253.[CrossRef][Medline]

  22. Sheardown SA, Duthie SM, Johnston CM et al. Stabilization of XIST RNA mediates initiation of X chromosome inactivation. Cell 1997;91:99–107.[CrossRef][Medline]

  23. Panning B, Dausman J, Jaenisch R. X chromosome inactivation is mediated by XIST RNA stabilization. Cell 1997;90:907–916.[CrossRef][Medline]

  24. Okamoto I, Otte AP, Allis CD et al. Epigenetic dynamics of imprinted X inactivation during early mouse development. Science 2004;303: 644–649.[Abstract/Free Full Text]

  25. Huynh KD, Lee JT. Inheritance of a pre-inactivated paternal X chromosome in early mouse embryos. Nature 2003;426:857–862.[CrossRef][Medline]

  26. Mermoud JE, Costanzi C, Pehrson JR et al. Histone MacroH2A1.2 relocates to the inactive X chromosome after initiation and propagation of x-inactivation. J Cell Biol 1999;147:1399–1408.[Abstract/Free Full Text]

  27. Rasmussen TP, Mastrangelo MA, Eden A et al. Dynamic relocalization of histone MacroH2A1 from centrosomes to inactive X chromosomes during X inactivation. J Cell Biol 2000;150:1189–1198.[Abstract/Free Full Text]

  28. Costanzi C, Pehrson JR. Histone MacroH2A1 is concentrated in the inactive X chromosome of female mammals. Nature 1998;393:599–601.[CrossRef][Medline]

  29. MacDonald M, Hassold T, Harvey J et al. The origin of 47, XXY and 47, XXX aneuploidy: heterogeneous mechanisms and role of aberrant recombination. Hum Mol Genet 1994;3:1365–1371.[Abstract/Free Full Text]

  30. Hoffman L, Carpenter MK. Characterization and culture of human embryonic stem cells. Nat Biotechnol 2005;23:699–708.[CrossRef][Medline]

  31. Brown CJ. Equality of the sexes: mammalian dosage compensation. Semin Reprod Med 2001;19:125–132.[CrossRef][Medline]

  32. Sato N, Sanjuan IM, Heke M et al. Molecular signature of human embryonic stem cells and its comparison with the mouse. Dev Biol 2003;260:404–413.[CrossRef][Medline]

  33. Ginis I, Luo Y, Miura T et al. Differences between human and mouse embryonic stem cells. Dev Biol 2004;269:360–380.[CrossRef][Medline]

  34. Dhara SK, Benvenisty N. Gene trap as a tool for genome annotation and analysis of X chromosome inactivation in human embryonic stem cells. Nucleic Acids Res 2004;32:3995–4002.[Abstract/Free Full Text]

Received December 27, 2004; accepted for publication August 11, 2005.



This article has been cited by other articles:


Home page
Hum ReprodHome page
X. Sun, X. Long, Y. Yin, Y. Jiang, X. Chen, W. Liu, W. Zhang, H. Du, S. Li, Y. Zheng, et al.
Similar biological characteristics of human embryonic stem cell lines with normal and abnormal karyotypes
Hum. Reprod., October 1, 2008; 23(10): 2185 - 2193.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Shen, Y. Matsuno, S. D. Fouse, N. Rao, S. Root, R. Xu, M. Pellegrini, A. D. Riggs, and G. Fan
X-inactivation in female human embryonic stem cells is in a nonrandom pattern and prone to epigenetic alterations
PNAS, March 25, 2008; 105(12): 4709 - 4714.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. S. Silva, R. K. Rowntree, S. Mekhoubad, and J. T. Lee
X-chromosome inactivation and epigenetic fluidity in human embryonic stem cells
PNAS, March 25, 2008; 105(12): 4820 - 4825.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
C. S. Navara, J. D. Mich-Basso, C. J. Redinger, A. Ben-Yehudah, E. Jacoby, E. Kovkarova-Naumovski, M. Sukhwani, K. Orwig, N. Kaminski, C. A. Castro, et al.
Pedigreed Primate Embryonic Stem Cells Express Homogeneous Familial Gene Profiles
Stem Cells, November 1, 2007; 25(11): 2695 - 2704.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. C. Chow, L. L. Hall, S. E. L. Baldry, N. P. Thorogood, J. B. Lawrence, and C. J. Brown
Inducible XIST-dependent X-chromosome inactivation in human somatic cells is reversible
PNAS, June 12, 2007; 104(24): 10104 - 10109.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
C. Allegrucci and L.E. Young
Differences between human embryonic stem cell lines
Hum. Reprod. Update, March 1, 2007; 13(2): 103 - 120.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. Hellman and A. Chess
Gene Body-Specific Methylation on the Active X Chromosome
Science, February 23, 2007; 315(5815): 1141 - 1143.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. A. Vickers, S. J. Canning, W. L. Craig, N. M. Masson, and I. J. Wilson
X Inactivation Patterns of Closely, but Not Distantly, Related Cells Are Highly Correlated: Little Evidence for Stem Cell Plasticity in Normal Females
Stem Cells, November 1, 2006; 24(11): 2398 - 2405.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. S. Rao
One Successful Series Begets Another
Stem Cells, October 1, 2006; 24(10): 2160 - 2161.
[Full Text] [PDF]


Home page
Genome ResHome page
M. Bibikova, E. Chudin, B. Wu, L. Zhou, E. W. Garcia, Y. Liu, S. Shin, T. W. Plaia, J. M. Auerbach, D. E. Arking, et al.
Human embryonic stem cells have a unique epigenetic signature
Genome Res., September 1, 2006; 16(9): 1075 - 1083.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0371v1
2004-0371v2
23/10/1468    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar