Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, C.
Right arrow Articles by Carpenter, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, C.
Right arrow Articles by Carpenter, M. K.

Stem Cells 2005;23:315-323 www.StemCells.com
© 2005 AlphaMed Press

Basic Fibroblast Growth Factor Supports Undifferentiated Human Embryonic Stem Cell Growth Without Conditioned Medium

Chunhui Xu, Elen Rosler, Jianjie Jiang, Jane S. Lebkowski, Joseph D. Gold, Chris O’Sullivan, Karen Delavan-Boorsma, Michael Mok, Adrienne Bronstein, Melissa K. Carpenter

Geron Corporation, Menlo Park, California, USA

Key Words. Human embryonic stem cells • Growth factors • Telomerase • Stem cell markers • Differentiation

Correspondence: Chunhui Xu, Ph.D., Geron Corporation, 230 Constitution Drive, Menlo Park, California 94025, USA. Telephone: 650-473-7795; fax: 650-473-7750; e-mail: cxu{at}geron.com


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies have shown that prolonged propagation of undifferentiated human embryonic stem cells (hESCs) requires conditioned medium from mouse embryonic feeders (MEF-CM) as well as matrix components. Because hESCs express growth factor receptors, including those for basic fibroblast growth factor (bFGF), stem cell factor (SCF), and fetal liver tyrosine kinase-3 ligand (Flt3L), we evaluated these and other growth factors for their ability to maintain undifferentiated hESCs in the absence of conditioned medium. We found cultures maintained in bFGF alone or in combination with other factors showed characteristics similar to MEF-CM control cultures, including morphology, surface marker and transcription factor expression, telomerase activity, differentiation, and karyotypic stability. In contrast, cells in media containing Flt-3L, thrombopoietin, and SCF, individually or in combination, showed almost complete differentiation after 6 weeks in culture. These data demonstrate that hESCs can be maintained in nonconditioned medium using growth factors.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human embryonic stem cells (hESCs) are considered to be the most primitive stem cell population and continuously proliferate when maintained in appropriate conditions for prolonged periods of time [15]. In addition to this self-renewal ability, hESCs differentiate both in vivo and in vitro, generating representatives of all three embryonic germ layers, including neural progenitors, cardiomyocytes, trophoblast cells, endothelial cells, hematopoietic lineages, hepatocyte-like cells, osteoblasts, and insulin-expressing cells [520]. Because of these fundamental characteristics, hESCs hold promise for cell-based therapies for degenerative diseases. However, widespread therapeutic application requires reliable scaled production of well-characterized hESCs. This type of production will require the determination of critical components that support hESC propagation in the undifferentiated state. Our previous work demonstrated that growth of undifferentiated hESCs could be maintained in feeder-free culture in which matrix proteins, such as matrigel or laminin, and soluble factors in mouse embryonic feeder conditioned medium (MEF-CM) were provided [5]. hESCs maintained in these feeder-free conditions remain stable even after continuous culture for longer than 1 year [4]. Using flow cytometry and interrogation of an expressed sequence tag (EST) database created from sequences from cDNA libraries generated from pooled samples of undifferentiated hESCs or differentiated hESC populations, we found that hESCs express receptors for stem cell factor (SCF), fetal liver tyrosine kinase-3 ligand (Flt3L), and fibroblast growth factors (FGFs) but not gp130, a common subunit of the receptor for the interleukin (IL)-6 family [21]. Therefore, we tested these and other growth factors for their capacity to maintain undifferentiated hESCs. We tested basic FGF (bFGF), SCF, Flt3L, thrombopoietin (TPO), and the IL-6 family members IL-6, leukemia inhibitory factor (LIF), ciliary neurotrophic factor (CNTF), and oncostatin M (OSM). Some of these factors have shown effects in other pluripotent cell populations. For instance, factors in the IL-6 family maintain the pluripotentiality of mouse embryonic stem (ES) cells through activation of the STAT3 pathway [2227]. In addition, growth of human primordial germ cells requires LIF, SCF, and bFGF [28], whereas SCF, FLT3L, TPO, and IL-6 synergize with each other to promote expansion of hematopoietic progenitors [2937]. In this report, we demonstrate that hESCs can be maintained in bFGF or bFGF in combination with other growth factors in a serum replacement nonconditioned medium (SR medium).


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
hESC Culture
hES H7 and H9 cells were initially maintained on feeders and transferred to feeder-free conditions as described previously [5, 38]. To examine the effect of growth factors on the growth of hESCs, cells maintained in MEF-CM were passaged into matrigel-coated plates in SR medium (embryonic stem cell medium, ESM as described previously [5] without bFGF) supplemented with growth factors. The following growth factor combinations were examined: A (MEF-CM control), B (SR medium without growth factors), C (40 ng/ml bFGF), D (40 ng/ml bFGF and 15 ng/ml SCF), E (40 ng/ml bFGF and 75 ng/ml Flt3L), F (40 ng/ml bFGF and 100 ng/ml TPO), G (40 ng/ml bFGF and 100 ng/ml LIF), H (40 ng/ml bFGF, 15 ng/ml SCF, and factors in IL-6 family, including 15 ng/ml IL-6, 100 ng/ml LIF, 50 ng/ml CNTF, and 50 ng/ml OSM), I (15 ng/ml SCF), J (100 ng/ml SCF), K (75 ng/ml Flt3L), L (100 ng/ml TPO), M (15 ng/ml SCF and 75 ng/ml Flt3L), N (15 ng/ml SCF and 100 ng/ml TPO), O (100 ng/ml SCF, 100 ng/ml Flt3L, and 15 ng/ml IL-6), P (40 ng/ml bFGF, 15 ng/ml SCF, and 75 ng/ml Flt3L), and Q (40 ng/ml bFGF, 15 ng/ml SCF, and 100 ng/ml TPO). Human recombinant bFGF was from Invitrogen (Carlsbad, CA), LIF was from Sigma (St. Louis, MO) and Chemicon International, Inc. (Temecula, CA), OSM was from Sigma and other growth factors were from R&D Systems (Minneapolis, MN). bFGF stock solution was prepared as previously described [38]. These growth factors have been shown to work independently or synergistically to support the growth of pluripotent cell populations, such as mouse embryonic stem cells, primordial germ cells, and hematopoietic progenitors [3941]. In our experiments, we included these growth factors at doses close to or higher than previously described. For instance, CNTF at 10 to 50 ng/ ml and OSM at 10 to 50 ng/ml have been used to culture mouse ES cells [24, 42, 43]; LIF at 10 to 20 ng/ml (or ~ 1,000 U/ml) maintains the pluripotentiality of mouse ES cells [42] and mouse [44] and human primordial germ cells [28]; TPO at 50 ng/ml was reported to expand hematopoietic progenitors [45]; and SCF at 60 ng/ml acts as a mitogen for murine primordial germ cells [46]. bFGF at 4 to 8 ng/ml has been used to supplement media for culture of hESCs on feeders or in feeder-free systems [5, 38]. We increased the bFGF concentration to 40 ng/ml for this study. Medium exchange was performed daily except at day 2 after plating for all cultures. The cultures were passaged weekly using collagenase IV treatment for 10 to 20 minutes and seeded at split ratios of 1:2 to 1:6. For each culture condition, growth factors were added to the SR medium at the time of medium exchange. The growth factors were present throughout the culture period in all experiments. Other materials and techniques are similar to feeder-free culture methods for hESCs [5, 38].

Flow Cytometry
hESCs were dissociated using 0.5 mM EDTA in phosphate-buffered saline (PBS), resuspended to approximately 5 x 105 cells/sample, and blocked with 20% heat-inactivated rabbit serum (Jackson Immuno Research Laboratories, Inc., West Grove, PA). The staining was performed using buffer containing 2% heat-inactivated fetal bovine serum (HyClone, Logan, UT), 0.1% sodium azide, and 2 mM EDTA in PBS. The cells were then incubated with the primary antibodies, phycoerythrin (PE)-conjugated antibodies, or appropriate isotype-matched controls (Southern Biotechnology Associates, Birmingham, AL; Sigma, St. Louis, MO or BD Biosciences Pharmingen, San Diego, CA) for 30 minutes at 4°C. Primary antibodies used were MC813 (stage-specific embryonic antigen-4 [SSEA4]), 1:5 (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA); TRA-1-60, 1:12; TRA-1-81, 1:20 (a gift from Dr. Peter Andrews, University of Sheffield, UK);andanti-FGFR,1:25(Biogenesis, Brentwood, NH). PE-conjugated antibodies used were CD9-PE, 1:5 (BD Biosciences PharMingen, San Diego, CA). Cells were washed two to three times in staining buffer and incubated for 30 minutes at 4°C with fluorescein isothiocyanate–conjugated goat F(ab')2 anti-mouse immunoglobulin (Ig) G3, 1:100, and PE-conjugated goat F(ab')2 anti-mouse IgM, 1:100 (Southern Biotechnology Associates, Birmingham, AL). The cells were washed and resuspended for analysis in staining buffer containing 1 µg/ml of propidium iodide (PI) (Sigma, St. Louis, MO) to identify nonviable cells. Flow cytometric analysis was performed using a FACSCalibur Flow Cytometer (BD Bioscience, San Jose, CA). At least 10,000 PI-negative events were collected. Acquired data were analyzed using CELLQuest software (BD Bioscience, San Jose, CA).

Quantitative Reverse Transcription–Polymerase Chain Reaction of OCT3/4, Cripto, and hTERT
RNA was isolated using an Rneasy kit (Qiagen, Valencia, CA) and subsequently treated with DNAse (Ambion, Woodlands, TX). For relative quantification of gene expression, standard real-time reverse transcription reactions were performed with a TaqMan 7700 sequence detection system (Applied Biosystems, Foster City, CA). TaqMan one-step reverse transcription–polymerase chain reaction (RT-PCR) master mix (Applied Biosystems, Foster City, CA) was applied using the following reaction conditions: RT at 48°C for 30 minutes; denaturation and AmpliTaq gold activation at 95°C for 10 minutes; amplification for 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. 18S ribosomal RNA was amplified to serve as a control using a kit for TaqMan ribosomal RNA control reagents (Applied Biosystems, Foster City, CA). Primers for OCT3/4 (NM_002701 [GenBank] ) were 5'GAAACCCACACTGCAGCAGA3' and 5'CACATCCTTCTCGAGCCCA3'. The probe for OCT3/4 was FAM-5'CAGCCACATCGCCCAGCAGC3'-TAM. The primers for cripto (or teratocacinoma-derived growth factor, NM_003212 [GenBank] ) were 5'TGAGCACGATGTGCGC3' and 5'TTCTTGGGCAGCCAGGTG3', and the cripto probe was FAM-5'AGAGAACTGTGGGTCTGTGCCCCATG3'-TAM. The primers and probe for hTERT were purchased from Applied Biosystems. Reactions were analyzed by ABI Prism 7700 Sequence Detection system, and the relative quantitation of gene expression was achieved by normalization against endogenous 18S ribosomal RNA (Applied Biosystems, Foster City, CA) using the {Delta}{Delta}CT method described in ABI User Bulletin #2, Relative Quantitation of Gene Expression, 1997. Relative fold difference in gene expression was calculated as 2-({Delta}{Delta}CT), where {Delta}{Delta}CT represents the cycle difference between the culture conditions corrected for 18S.

Karyotype Analysis
Cytogenetic analysis was performed by the Medical Genetics Cytogenetics Laboratory at Children’s Hospital, Oakland, CA, using the G banding method. The analysis was based on 20 to 30 cells for each sample.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Growth of hESCs in Growth Factor-Containing Media
To evaluate the role of growth factors in hESC growth, we tested a number of factors that are known to support proliferation of other stem cells. H7 cells (passage 35) and H9 cells (passage 30) maintained on matrigel in MEF-CM were dissociated into small clumps and plated onto matrigel-coated plates using SR medium supplemented with growth factors individually or in combinations as listed in the Materials and Methods section. Cultures in SR medium alone or MEF-CM were used as negative and positive controls, respectively. After 1 week, positive control cultures (MEF-CM, condition A) reached confluence and most of the surface areas of the culture dish contained undifferentiated colonies, whereas the remaining areas were covered with differentiated cells. In contrast, the other culture conditions tested (conditions B, I-Q) showed fewer undifferentiated colonies compared with MEF-CM. Morphological differences between conditions became more apparent after subsequent weekly passaging. At passage 6 (48 days), many colonies with undifferentiated hESC morphology were found in H7 cultures that contained bFGF (conditions C-H, P, Q), whereas cultures without bFGF (conditions B, I-O) contained mostly differentiated cells (Fig. 1AGo). Similar morphological changes were also observed when H9 cells were maintained in these conditions for two passages. Of particular interest is the finding that hESC cultures can be maintained in bFGF alone. A comparison of proliferation rate of H9 cells maintained in MEF-CM with SR media supplemented with bFGF shows similar doubling rates in both conditions (Fig. 1BGo).



View larger version (62K):
[in this window]
[in a new window]
 
Figure 1. Morphology and growth of human embryonic stem cells maintained in growth factors. (A): Representative morphology of H7 cells maintained in various conditions for six passages. The morphologies of cells in conditions without bFGF (conditions B, I, J, K, L, M, N, and O) were similar, whereas cells in conditions with bFGF were similar to one another. Bar = 800 µm. (B): Proliferation of H9 cells in MEF-CM or bFGF-containing medium. Cells maintained in MEF-CM or SR medium containing 40 ng/ml bFGF for 12 passages were dissociated with collagenase IV, resuspended in CM or SR medium containing 40 ng/ml bFGF, and plated onto matrigel-coated 24-well plates. At days 1, 3, 5, and 7 after seeding, cells were harvested with trypsin/EDTA, and the number of live cells was determined by trypan blue exclusion. Each point on the graph represents the mean ± standard deviation of cell counts for three separate wells. Growth curves were generated from these data, and the approximate doubling time was calculated using linear regression to be 28 hours for both conditions. Abbreviations: bFGF, basic fibroblast growth factor; MEF-CM, mouse embryonic feeder conditioned medium; SR, serum replacement.

 
Expression of Surface Markers
To further evaluate the undifferentiated phenotype of hESCs maintained in the different growth factor cocktails, we analyzed expression of SSEA4 and TRA-1-81 using two-color flow cytometry. These surface markers are expressed consistently in undifferentiated hESCs isolated from different laboratories maintained on feeders or in feeder-free conditions and decrease upon differentiation [1, 2, 5, 47, 48]. hESC cultures maintained in MEF-CM possessed a large percentage of cells expressing high levels of SSEA4 (SSEA4hi) or TRA-1-81 (TRA-1-81hi) and had a high percentage of morphologically undifferentiated cells, whereas a smaller portion of cells expressed no or lower levels of SSEA4. Comparison of H7 cells maintained (for six passages) in MEF-CM or media supplemented with growth factors showed that 95% of the cells in MEF-CM (condition A) and 43% to 80% of the cells in media supplemented with bFGF alone or combined with other factors (conditions C-H, P, Q) expressed SSEA4 and TRA-1-81 at high levels (SSEA4hi/TRA-1-81hi). In contrast, cultures without bFGF (conditions B, I-O) showed considerable less expression, with fewer than 16% of the cells showing SSEA4hi/TRA-1-81hi expression (Fig. 2Go). Similarly, the percentage of SSEA4hi or TRA-1-81+ (total TRA-1-81–positive cells) cells in conditions supplemented with bFGF (conditions C-H, P, Q) was higher than that in conditions without bFGF (conditions B, I-O) (Fig. 2Go). These results indicate that bFGF alone or in combination with other factors maintained the expression of these markers in the hESC cultures. In contrast, maintenance of the cultures in Flt3L, SCF, LIF, and TPO without bFGF resulted in a significant decrease in expression of the markers, which correlated with a differentiated morphology. Consistent with results at passage 6, 98% of the cells in MEF-CM (condition A), 90% of the cells in medium supplemented with bFGF + Flt3L (condition E), and 59% to 75% of the cells in other conditions containing bFGF (conditions C, F, G, H, P, and Q) were SSEA-4hi at passage 11 (Fig. 3Go). In addition, in all the cultures maintained in bFGF and growth factors, most of the SSEA4hi cells expressed TRA-1-60 [1, 2, 5, 48] and CD9, a tetraspan transmembrane protein [49], another surface marker that is highly expressed in undifferentiated hESCs [4] (Fig. 3Go). These results suggest that bFGF or bFGF in combination with other factors can maintain surface marker expression in hESCs. Expression of surface markers was confirmed by immunocytochemical analysis using a second cell line, H9. Similar to cells maintained in MEF-CM, undifferentiated H9 cells maintained in bFGF for 15 passages expressed SSEA4, TRA-1-61, TRA-1-81, and alkaline phosphatase in the undifferentiated colonies (online Fig. 1Go). Similar to control cultures, the differentiated cells in between the colonies did not express these markers (online Fig. 1Go).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 2. Expression of SSEA4 and TRA-1-81 in human embryonic stem cells maintained in various conditions. (A): Representative samples of SSEA4 and TRA-1-81 expression on H7 cells maintained in conditions A (MEF-CM), B (SR medium), C (bFGF), D (bFGF + SCF), and E (bFGF + Flt3L) for six passages. The subset of population expressing SSEA4 at high levels was defined as SSEA4hi population. The cells expressing SSEA4 compared with isotype control (gray peaks) were termed SSEA4+ population. Expression of TRA-1-81 was similarly defined as TRA-1-81hi and TRA-1-81+. Percentages of double positive for TRA-1-81hi/SSEA4hi were indicated in the dot blots. (B): Summary of SSEA4+, TRA-1-81+, and SSEA4hi as well as double positive for TRA-1-81hi/SSEA4hi expression in H7 cells maintained in various conditions for six passages. Data were generated from analysis of at least 10,000 propidium iodide–negative cells (viable cells). + indicates conditions with bFGF, and – indicates conditions without bFGF. Abbreviations: bFGF, basic fibroblast growth factor; MEF-CM, mouse embryonic feeder conditioned medium; SCF, stem cell factor; SSEA, stage-specific embryonic antigen; SR, serum replacement.

 


View larger version (59K):
[in this window]
[in a new window]
 
Figure 3. Flow cytometry analysis of surface markers of human embryonic stem cells maintained in growth factors. (A): Representative samples of SSEA4 and TRA-1-60 and CD9 expression on H7 cells. (B): Summary of surface marker expression in H7 cells maintained in various conditions containing bFGF for 11 passages. Abbreviations: bFGF, basic fibroblast growth factor; MEF-CM, mouse embryonic feeder conditioned medium; SCF, stem cell factor; SSEA, stage-specific embryonic antigen-4.

 
Expression of Other Markers for Undifferentiated hESCs
The Pit-Oct-Unc (POU) transcription factor octamer-binding transcription factor 3/4 (OCT3/4), the catalytic component of telomerase (human telomerase reverse transcriptase, hTERT), and the growth factor cripto are markers expressed by undifferentiated hESCs that downregulate upon differentiation [2, 4, 5, 7, 50, 51]. We performed quantitative RT-PCR TaqMan assays to determine the expression of OCT3/4, hTERT, and cripto in H7 cells maintained in various conditions for six passages. The fold change in mRNA expression for these markers was compared with that of control cultures maintained in MEF-CM. The analysis showed that H7 cells in bFGF-containing conditions (condition C-H, P, Q) maintained expression of OCT3/4, hTERT, and cripto at moderate levels compared with MEF-CM controls (Fig. 4Go). In contrast, cells in conditions without bFGF (except condition L) showed substantially lower levels of OCT3/4, hTERT, and cripto expression (more than five fold) (Fig. 4Go). These results show that hESCs in bFGF-containing media maintained expression of OCT3/4, hTERT, and cripto.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Real-time reverse transcription–polymerase chain reaction TaqMan analysis of OCT3/4, hTERT, and cripto expression in human embryonic stem cells maintained in various conditions. The relative fold differences in H7 cells maintained in various conditions for six passages compared with control mouse embryonic feeder conditioned medium culture are presented as mean values ± standard deviations from triplicate assays. + indicates conditions with bFGF, and - indicates conditions without bFGF. Abbreviation: bFGF, basic fibroblast growth factor.

 
Telomerase Activity
Because hESCs proliferate indefinitely, we assessed telomerase activity in cultures maintained in growth factors. Consistent with the expression of hTERT, hESCs maintained in bFGF alone or with other factors for 15 passages had telomerase activity as confirmed by the telomeric repeat amplification protocol (TRAP) assay [52, 53] (Fig. 5AGo).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 5. Characterization of human embryonic stem cells maintained in growth factors. (A): TRAP analysis of telomerase activity in H7 cell cultures maintained in growth factors for 15 passages. A total of 5,000 or 1,000 cells were used for each sample. Heat inactivated (HI) samples were used as controls. (B): A representative sample of cytogenetic analysis of H7 cells maintained in basic fibroblast growth factor–containing medium for 15 passages.

 
Cytogenetic Analysis
hESCs have shown karyotypic stability over long-term culture [3]. However, aneuploidy has been detected in cultures maintained on feeders or in feeder-free conditions [4, 54]. To determine if cells grown in the conditions tested here maintain a normal karyotype, cytogenetic analysis was performed using H7 cells maintained in MEF-CM, in bFGF alone, or with other factors (conditions A, C, D, E, F, P, Q) for 15 passages (Fig. 5BGo). Cultures maintained a normal karyotype in all conditions except cultures in bFGF + SCF + TPO (condition Q), in which 4 of 30 metaphases showed trisomy 12, whereas the remaining 26 metaphases had a normal female karyotype (online Table 1). It is unclear whether this abnormality is specific to the culture condition, because trisomy 12 has also been reported in cultures on feeders or feeder-free conditions [54]. In addition, three independent H9 cultures maintained in bFGF alone at passage 4 and 15 and one H9 cell culture maintained in bFGF + SCF + IL-6 family (condition H) at passage 14 were also subjected to cytogenetic analysis and showed a normal karyotype (online Table 1). These data indicate that the hESC cultures can maintain a normal karyotype under growth conditions without feeders or conditioned medium.

Differentiation Capacity
One of the defining characteristics of hESCs is pluripotency; therefore the hESCs grown without conditioned medium were evaluated for their differentiative capacity. In vitro differentiation was assessed after H7 hESCs maintained in bFGF alone or in combination with other factors had undergone 15 passages. The cells readily formed embryoid bodies (EBs) that were subsequently plated after 4 days in suspension and further differentiated for 7 days. Heterogeneous morphologies including beating cells were identified in EB outgrowths derived from cells maintained in all of the conditions tested. Immunocytochemical analysis of these cultures using methods described previously [5] demonstrated the presence of ß-tubulin III+ cells with neuron morphology, {alpha}-fetoprotein–positive cells, and smooth muscle actin–positive cells (Fig. 6AGo). Similarly, H9 cells in cultures containing bFGF differentiated after EB formation (online Fig. 2Go). These results indicate that hESCs grown in bFGF-containing medium maintained their capacity to differentiate into many cell types in vitro.



View larger version (135K):
[in this window]
[in a new window]
 
Figure 6. Differentiation of human embryonic stem cells maintained in growth factors. (A): In vitro differentiation of H7 cells. Examples of positive staining of AFP, ß-tubulin-III, and SMA in embryoid body outgrowths derived from H7 cells maintained in bFGF + Flt3L for 15 passages. (B): Teratomas derived from H9 cells maintained in bFGF for eight passages. Cartilage (a), primitive renal tissue (b), neural tube (c), glandular epithelium (d), pigmented epithelium (e), and mesenchymal tissue (f) were identified in teratomas. Abbreviations: AFP, {alpha}-fetoprotein; bGFG, basic fibroblast growth factor; SMA, smooth muscle actin.

 
To examine if the hESCs maintained in bFGF have the capacity to generate teratomas, H9 cells maintained in bFGF for eight passages were injected into severe combined immunodeficiency/beige mice as described previously [5]. Like the cells maintained in MEF-CM, these cells formed teratomas. Histological analysis indicated that tumors consisted of multiple cell types and tissue structures, including cartilage, primitive renal tissue, glandular epithelium, pigmented epithelium, nervous tissue, and mesenchymal tissue (Fig. 6BGo). Therefore, cells maintained with bFGF retain their ability to differentiate in vivo.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The aim of this study was to determine the minimal combination of growth factors that maintain the proliferation and pluripotency of undifferentiated hESCs without use of feeder cells or conditioned medium. Based on cumulative data including cell morphology, surface markers and gene expression, telomerase activity, karyotype, and differentiation capacity, our results suggest that bFGF alone or in combination with other growth factors supports hESC growth. In contrast, SCF, Flt3L, TPO, or LIF (alone or in combination) without bFGF is not sufficient to maintain the growth of undifferentiated cells. In our current feeder-free culture method, passaging hESCs as small cell clumps rather than single cells using collagenase IV is preferable. Cell density is also critical for maintaining the hESCs [5, 38]. Based on these observations, we hypothesize that it is likely that cell-cell contact and membrane-associated factors are important for the proliferation of hESCs and that hESCs will only retain their pluripotency with appropriate microenvironments. It is also possible that hESCs produce growth factors during culture that may play a role in maintaining the undifferentiated hESCs. However, our study suggests that the autocrine and paracrine factors produced by hESCs are not adequate to support the growth of hESCs in long-term culture. Although undifferentiated colonies could be identified at early passages in all conditions, hESCs maintained in the SR medium without the addition of bFGF differentiated after a few passages. Although we can not rule out the roles of undefined factors in the base SR medium, matrigel, and factors produced by undifferentiated and differentiated hESCs, it is clear that these conditions without bFGF are not sufficient to maintain the growth of undifferentiated hESCs in long-term culture.

Our data from two hESC lines (H7 and H9 cells) confirmed a role for bFGF in supporting hESC growth, which is consistent with our findings [4], and microarray studies reported recently [48] on FGF receptor expression profiles in hESC cultures. Because FGFR1 is detected in subsets of both SSEA4hi and SSEA4–/low populations [4], these growth factors may stimulate undifferentiated hESC proliferation directly or act indirectly via stimulation of differentiated cells in the culture to produce factors for maintaining undifferentiated cells. In this study, we observed a similar FGFR1 expression profile when hESCs were cultured in MEF-CM or bFGF-containing medium (data not shown). It is also likely that growth factors have the capacity to block differentiation of hESCs, because bFGF can inhibitmaturation of oligodendrocyte precursors [55, 56]. Alternatively, bFGF may interact with other receptors, such as FGFR2, FGFR3, and FGFR4, which are present in undifferentiated hESCs based on analysis of our EST database [21]. On the other hand, bFGF may modulate other growth factor receptors that induce differentiation. Further research is needed to understand the mechanism of action for bFGF in maintaining the self-renewal of hESCs. Nevertheless, this study provides strong evidence that hESCs can be maintained using growth factor-supplemented medium in the absence of feeders or conditioned medium. This development allows further understanding of the molecular control of undifferentiated hESC expansion.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We thank Dr. Calvin Harley for critical review of the manuscript and Dr. Greg Fisk for advice on TaqMan assays. We thank Dr. Peter Andrews (University of Sheffield, UK) for TRA-1-60 and TRA-1-81 antibodies and Developmental Studies Hybridoma Bank for SSEA4 antibodies.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  2. Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000;18:399–404.[CrossRef][Medline]

  3. AmitM, Carpenter MK, Inokuma MS etal. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 2000;227:271–278.[CrossRef][Medline]

  4. Rosler ES, Fisk GJ, Ares X et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Dev Dyn 2004;229:259–274.[CrossRef][Medline]

  5. Xu C, Inokuma MS, Denham J et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nature Biotech 2001;19:971–974.[CrossRef][Medline]

  6. Carpenter MK, Inokuma MS, Denham J et al. Enrichment of neurons and neural precursors from human embryonic stem cells. Exp Neurol 2001;172:383–397.[CrossRef][Medline]

  7. Lebkowski JS, Gold J, Xu C et al. Human embryonic stem cells: culture, differentiation, and genetic modification for regenerative medicine applications. Cancer J 2001;7(suppl 2):S83–S93.

  8. Xu C, Police S, Rao N et al. Characterization and enrichment of cardiomyocytes derived from human embryonic stem cells. Circ Res 2002;91:501–508.[Abstract/Free Full Text]

  9. Kehat I, Kenyagin-Karsenti D, Snir M et al. Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. J Clin Invest 2001;108:407–414.[CrossRef][Medline]

  10. Xu RH, Chen X, Li DS et al. BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nat Biotechnol 2002;20:1261–1264.[CrossRef][Medline]

  11. Odorico JS, Kaufman DS, Thomson JA. Multilineage differentiation from human embryonic stem cell lines. Stem Cells 2001;19:193–204.[Abstract/Free Full Text]

  12. Mummery C, Ward D, van den Brink CE et al. Cardiomyocyte differentiation of mouse and human embryonic stem cells. J Anat 2002;200:233–242.[CrossRef][Medline]

  13. Levenberg S, Golub JS, Amit M et al. Endothelial cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 2002;99:4391–4396.[Abstract/Free Full Text]

  14. Zhang SC, Wernig M, Duncan ID et al. In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat Biotechnol 2001;19:1129–1133.[CrossRef][Medline]

  15. Kaufman DS, Hanson ET, Lewis RL et al. Hematopoietic colony-forming cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 2001;98:10716–10721.[Abstract/Free Full Text]

  16. Assady S, Maor G, Amit M et al. Insulin production by human embryonic stem cells. Diabetes 2001;50:1691–1697.[Abstract/Free Full Text]

  17. Schuldiner M, Yanuka O, Itskovitz-Eldor J et al. Effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 2000;92:11307–11312.

  18. Rambhatla L, Chiu CP, Kundu P et al. Generation of hepatocyte-like cells from human embryonic stem cells. Cell Transplant 2003;12:1–11.[Medline]

  19. Chadwick K, Wang L, Li L et al. Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells. Blood. 2003;102:906–915.[Abstract/Free Full Text]

  20. Sottile V, Thomson A, McWhir J. In vitro ostrogenic potential of human ES cells. Cloning Stem Cells 2003;5:149–155.[CrossRef][Medline]

  21. Carpenter MK, Rosler ES, Fisk GJ et al. Properties of four human embryonic stem cell lines maintained in a feeder-free culture system. Dev Dyn 2004;229:243–258.[CrossRef][Medline]

  22. Smith AG, Heath JK, Donaldson DD et al. Inhibition of pluripotential embryonic stem cell differentation by purified polypeptides. Nature 1988;336:688–690.[CrossRef][Medline]

  23. Williams RL, Hilton DJ, Pease S et al. Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 1988;336:684–687.[CrossRef][Medline]

  24. Rose TM, Weiford DM, Gunderson NL et al. Oncostatin M (OSM) inhibits the differentiation of pluripotent embryonic stem cells in vitro. Cytokine 1994;6:48–54.[CrossRef][Medline]

  25. Nichols J, Chambers I, Smith A. Derivation of germline competent embryonic stem cells with a combination of interleukin-6 and soluble interleukin-6 receptor. Exp Cell Res 1994;215:237–239.[CrossRef][Medline]

  26. Niwa H, Burdon T, Chambers I et al. Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 1998;12:2048–2060.[Abstract/Free Full Text]

  27. Conover JC, Ip NY, Poueymirou WT et al. Ciliary neurotrophic factor maintains the pluripotentiality of embryonic stem cells. Development 1993;119:559–565.[Abstract]

  28. Shamblott MJ, Axelman J, Wang S et al. Derivation of pluripotent stem cells from cultured human primordial germ cells. Proc Natl Acad Sci U S A 1998;95:13726–13731.[Abstract/Free Full Text]

  29. Audet J, Miller CL, Rose-John S et al. Distinct role of gp130 activation in promoting self-renewal divisions by mitogenically stimulated murine hematopoietic stem cells. Proc Natl Acad Sci U S A 2001;98:1757–1762.[Abstract/Free Full Text]

  30. Verfaillie CM. Optimizing hematopoietic stem cell engraftment: a novel role for thrombopoietin. J Clin Invest 2002;110:303–304.[CrossRef][Medline]

  31. Mackarehtschian K, Hardin JD, Moore KA et al. Targeted disruption of the flk2/flt3 gene leads to deficiencies in primitive hematopoietic progenitors. Immunity 1995;3:147–161.[CrossRef][Medline]

  32. Bernstein A, Forrester L, Reith AD et al. The murine W/c-kit and Steel loci and the control of hematopoiesis. Semin Hematol 1991;28:138–142.[Medline]

  33. Fox N, Priestley G, Papayannopoulou T et al. Thrombopoietin expands hematopoietic stem cells after transplantation. J Clin Invest 2002;110:389–394.[CrossRef][Medline]

  34. Wagers AJ, Christensen JL, Weissman IL. Cell fate determination from stem cells. Gene Ther 2002;9:606–612.[CrossRef][Medline]

  35. Yagi M, Ritchie KA, Sitnicka E et al. Sustained ex vivo expansion of hematopoietic stem cells mediated by thrombopoietin. Proc Natl Acad Sci U S A 1999;96:8126–8131.[Abstract/Free Full Text]

  36. Luskey BD, Rosenblatt M, Zsebo K et al. Stem cell factor, interleukin-3, and interleukin-6 promote retroviral-mediated gene transfer into murine hematopoietic stem cells. Blood 1992;80:396–402.[Abstract/Free Full Text]

  37. Ema H, Takano H, Sudo K et al. In vitro self-renewal division of hematopoietic stem cells. J Exp Med 2000;192:1281–1288.[Abstract/Free Full Text]

  38. Carpenter MK, Xu C, Daigh CA et al. Protocols for the isolation and maintenance of human embronic stem cells. In: Chiu A, Rao MS, eds. Human Embryonic Stem Cells. Totowa, NJ: Humana Press, 2003.

  39. Broudy VC. Stem cell factor and hematopoiesis. Blood 1997;90:1345–1364.[Free Full Text]

  40. Donovan PJ, Gearhart J. The end of the beginning for pluripotent stem cells. Nature 2001;414:92–97.[CrossRef][Medline]

  41. Ogawa M. Differentiation and proliferation of hematopoietic stem cells. Blood 1993;81:2844–2853.[Abstract/Free Full Text]

  42. Conover JC, Ip NY, Poueymirou WT et al. Ciliary neurotrophic factor maintains the pluripotentiality of embryonic stem cells. Development 1993;119:559–565.

  43. Vassilieva S, Guan K, Pich U et al. Establishment of SSEA-1- and Oct-4-expressing rat embryonic stem-like cell lines and effects of cytokines of the IL-6 family on clonal growth. Exp Cell Res 2000;258:361–373.[CrossRef][Medline]

  44. Matsui Y, Zaebo K, Hogan BLM. Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell 1992;70:841–847.[CrossRef][Medline]

  45. Borge OJ, Ramsfjell V, Cui L et al. Ability of early acting cytokines to directly promote survival and suppress apoptosis of human primitive CD34+CD38 bone marrow cells with multilineage potential at the single-cell level: key role of thrombopoietin. Blood 1997;90:2282–2292.[Abstract/Free Full Text]

  46. Matsui Y, Toksoz D, Nishikawa S et al. Effect of Steel factor and leukaemia inhibitory factor on murine primordial germ cells in culture. Nature 1991;353:750–752.[CrossRef][Medline]

  47. Pera MF, Reubinoff B, Trounson A. Human embryonic stem cells. J Cell Sci 2000;113(pt 1):5–10.[Abstract]

  48. Draper JS, Pigott C, Thomson JA et al. Surface antigens of human embryonic stem cells: changes upon differentiation in culture. J Anat 2002;200:249–258.[CrossRef][Medline]

  49. Oka M, Tagoku K, Russell TL et al. CD9 is associated with leukemia inhibitory factor-mediated maintenance of embryonic stem cells. Mol Biol Cell 2002;13:1274–1281.[Abstract/Free Full Text]

  50. Carpenter MK, Rosler E, Rao MS. Characterization and differentiation of human embryonic stem cells. Cloning Stem Cells 2003;5:79–88.[CrossRef][Medline]

  51. Brivanlou AH, Gage FH, Jaenisch R et al. Stem cells: setting standards for human embryonic stem cells. Science 2003;300:913–916.[Abstract/Free Full Text]

  52. Kim NY, Piatyszek MA, Prowse KR et al. Specific association of human telomerase activity with immortal cell lines and cancer. Science 1994;266:2011–2015.[Abstract/Free Full Text]

  53. Weinrich SL, Pruzan R, Ma L et al. Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT. Nature Genet 1997;17:498–502.[CrossRef][Medline]

  54. Draper JS, Smith K, Gokhale P et al. Recurrent gain of chromosomes 17q and 12 in cultured human embryonic stem cells. Nat Biotechnol 2004;22:53–54.[CrossRef][Medline]

  55. McKinnon RD, Matsui T, Dubois-Dalcq M et al. FGF modulates the PDGF-driven pathway of oligodendrocyte development. Neuron 1990;5:603–614.[CrossRef][Medline]

  56. Bogler O, Wren D, Barnett SC et al. Cooperation between two growth factors promotes extended self-renewal and inhibits differentiation of oligodendrocyte-type-2 astrocyte (O-2A) progenitor cells. Proc Natl Acad Sci U S A 1990;87:6368–6372.[Abstract/Free Full Text]

Received August 26, 2004; accepted for publication November 5, 2004.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Z. Wu, W. Zhang, G. Chen, L. Cheng, J. Liao, N. Jia, Y. Gao, H. Dai, J. Yuan, L. Cheng, et al.
Combinatorial Signals of Activin/Nodal and Bone Morphogenic Protein Regulate the Early Lineage Segregation of Human Embryonic Stem Cells
J. Biol. Chem., September 5, 2008; 283(36): 24991 - 25002.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
B.V. Johnson, N. Shindo, P.D. Rathjen, J. Rathjen, and R.A. Keough
Understanding pluripotency--how embryonic stem cells keep their options open
Mol. Hum. Reprod., September 1, 2008; 14(9): 513 - 520.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. Yu and J. A. Thomson
Pluripotent stem cell lines
Genes & Dev., August 1, 2008; 22(15): 1987 - 1997.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
U. Ullmann, C. Gilles, M. De Rycke, H. Van de Velde, K. Sermon, and I. Liebaers
GSK-3-specific inhibitor-supplemented hESC medium prevents the epithelial-mesenchymal transition process and the up-regulation of matrix metalloproteinases in hESCs cultured in feeder-free conditions
Mol. Hum. Reprod., March 1, 2008; 14(3): 169 - 179.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Y. Mayshar, E. Rom, I. Chumakov, A. Kronman, A. Yayon, and N. Benvenisty
Fibroblast Growth Factor 4 and Its Novel Splice Isoform Have Opposing Effects on the Maintenance of Human Embryonic Stem Cell Self-Renewal
Stem Cells, March 1, 2008; 26(3): 767 - 774.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
B. S. Soh, C. M. Song, L. Vallier, P. Li, C. Choong, B. H. Yeo, E. H. Lim, R. A. Pedersen, H. H. Yang, M. Rao, et al.
Pleiotrophin Enhances Clonal Growth and Long-Term Expansion of Human Embryonic Stem Cells
Stem Cells, December 1, 2007; 25(12): 3029 - 3037.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Wang, T. C. Schulz, E. S. Sherrer, D. S. Dauphin, S. Shin, A. M. Nelson, C. B. Ware, M. Zhan, C.-Z. Song, X. Chen, et al.
Self-renewal of human embryonic stem cells requires insulin-like growth factor-1 receptor and ERBB2 receptor signaling
Blood, December 1, 2007; 110(12): 4111 - 4119.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. Kim, S. E. Ahn, J. H. Lee, D.-S. Lim, K.-S. Kim, H.-M. Chung, and S.-H. Lee
A Novel Culture Technique for Human Embryonic Stem Cells Using Porous Membranes
Stem Cells, October 1, 2007; 25(10): 2601 - 2609.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. Pick, L. Azzola, A. Mossman, E. G. Stanley, and A. G. Elefanty
Differentiation of Human Embryonic Stem Cells in Serum-Free Medium Reveals Distinct Roles for Bone Morphogenetic Protein 4, Vascular Endothelial Growth Factor, Stem Cell Factor, and Fibroblast Growth Factor 2 in Hematopoiesis
Stem Cells, September 1, 2007; 25(9): 2206 - 2214.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. L. Garcia-Perez, M. C.N. Marchetto, A. R. Muotri, N. G. Coufal, F. H. Gage, K. S. O'Shea, and J. V. Moran
LINE-1 retrotransposition in human embryonic stem cells
Hum. Mol. Genet., July 1, 2007; 16(13): 1569 - 1577.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
F. Mannello and G. A. Tonti
Concise Review: No Breakthroughs for Human Mesenchymal and Embryonic Stem Cell Culture: Conditioned Medium, Feeder Layer, or Feeder-Free; Medium with Fetal Calf Serum, Human Serum, or Enriched Plasma; Serum-Free, Serum Replacement Nonconditioned Medium, or Ad Hoc Formula? All That Glitters Is Not Gold!
Stem Cells, July 1, 2007; 25(7): 1603 - 1609.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
A. J. Joannides, C. Fiore-Heriche, A. A. Battersby, P. Athauda-Arachchi, I. A. Bouhon, L. Williams, K. Westmore, P. J. Kemp, A. Compston, N. D. Allen, et al.
A Scaleable and Defined System for Generating Neural Stem Cells from Human Embryonic Stem Cells
Stem Cells, March 1, 2007; 25(3): 731 - 737.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Timmer, K. Cesnulevicius, C. Winkler, J. Kolb, E. Lipokatic-Takacs, J. Jungnickel, and C. Grothe
Fibroblast Growth Factor (FGF)-2 and FGF Receptor 3 Are Required for the Development of the Substantia Nigra, and FGF-2 Plays a Crucial Role for the Rescue of Dopaminergic Neurons after 6-Hydroxydopamine Lesion
J. Neurosci., January 17, 2007; 27(3): 459 - 471.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
M. Bhatia
Hematopoietic Development from Human Embryonic Stem Cells
Hematology, January 1, 2007; 2007(1): 11 - 16.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. Hasegawa, T. Fujioka, Y. Nakamura, N. Nakatsuji, and H. Suemori
A Method for the Selection of Human Embryonic Stem Cell Sublines with High Replating Efficiency After Single-Cell Dissociation
Stem Cells, December 1, 2006; 24(12): 2649 - 2660.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
L. Gruen and L. Grabel
Concise Review: Scientific and Ethical Roadblocks to Human Embryonic Stem Cell Therapy
Stem Cells, October 1, 2006; 24(10): 2162 - 2169.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. A. Noggle, D. Weiler, and B. G. Condie
Notch Signaling Is Inactive but Inducible in Human Embryonic Stem Cells
Stem Cells, July 1, 2006; 24(7): 1646 - 1653.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
L. Xiao, X. Yuan, and S. J. Sharkis
Activin A Maintains Self-Renewal and Regulates Fibroblast Growth Factor, Wnt, and Bone Morphogenic Protein Pathways in Human Embryonic Stem Cells
Stem Cells, June 1, 2006; 24(6): 1476 - 1486.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. S.G. Yeoh, R. van Os, E. Weersing, A. Ausema, B. Dontje, E. Vellenga, and G. de Haan
Fibroblast Growth Factor-1 and -2 Preserve Long-Term Repopulating Ability of Hematopoietic Stem Cells in Serum-Free Cultures
Stem Cel