|
|
||||||||
Department of Plastic and Reconstructive Surgery, University of Virginia, Charlottesville, VA, USA
Key Words. Adult stem cells • Flow cytometry • Microarray • Integrins
Correspondence: Adam J. Katz, M.D., P.O. Box 800376, Department of Plastic and Reconstructive Surgery, University of Virginia, Charlottesville, VA 22908, USA. Telephone: 434-924-8042; Fax: 434-924-1333; e-mail: ajk2f{at}virginia.edu
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Several groups have demonstrated that mesenchymal cells within the stromal-vascular fraction (SVF) of subcutaneous adipose tissue display multilineage developmental plasticity in vitro and in vivo [16]. These cells have alternatively been referred to as processed lipoaspirate cells (PLA), adipose-derived stem cells, adipose-derived stromal cells, and adipose-derived mesenchymal progenitor cells. It is also likely that cells previously considered preadipocytes are essentially the same cell population. These many names reflect a lack of consensus and an evolving knowledge base with regard to the anatomic origin, phenotype, and function of these cells. Our lab has chosen to refer to these cells as adipose-derived adherent stromal (ADAS) cells. This is a purely descriptive name that also provides some distinction from stromal vascular fraction (SVF) cells, which have not been further separated based on adherence to tissue culture plastic.
There are obvious similarities between hADAS cells and mesenchymal stem cells (MSCs). Both represent the stromal cell fraction isolated from an adipose depot (subcutaneous tissue for the former, bone marrow for the latter) on the basis of adherence to tissue culture plastic. While an extensive body of work exists pertaining to the phenotypic characterization of MSCs, the phenotypic characterization of hADAS cells is in its infancy [712]. The plasticity observed of cultured hADAS cells is intriguing and includes cell lineages thought of as ectodermal and mesodermal.
There are no known stem cellspecific markers for the prospective identification of putative stem cells or progenitor cells within adipose tissue, bone marrow, or any other mesodermally derived adult tissue. Based on extensive work with other stem cell populations, however, several proteins have emerged as candidate markers associated with a primitive, stem cell phenotype; these include telomerase, CD133, and ABCG2) [1318]. The purpose of this study was threefold: (1) to further characterize early passage, undifferentiated hADAS cells on a transcriptional and cell surface level, (2) to determine the degree of variability of cell populations isolated from different donors, and (3) to determine whether hADAS cells specifically exhibit markers that are associated with other stem cell populations.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies
See Table 1
for a full list of antibodies used and their commercial sources.
|
Cells were isolated from adipose tissue using methods previously described [1, 19]. Briefly, harvested tissue was washed several times and then enzymatically dissociated. The dissociated tissue was then filtered to remove debris, and the resulting cell suspension was centrifuged. Pelleted stromal cells were then recovered and washed several times. Contaminating erythrocytes were lysed with an osmotic buffer, and the stromal cells were plated onto tissue culture plastic (10-cm dishes). Cultures were washed with buffer 2448 hours after plating to remove unattached cells, and then re-fed with fresh medium. Plating and expansion medium consisted of DMEM/F12 with 10% FBS and antibiotic-antimycotic. Cultures were maintained at 37°C with 5% CO2 and fed three times per week.
Cells were grown to confluence after the initial plating (P = 0), typically within 1014 days. Once confluent, the adherent cells were released with 0.5% trypsin-EDTA and then either re-plated at 2 k/cm2 or used for experimental analysis. Cultures were passaged every 78 days until they were ready for analysis. All cells used for analysis were considered early passage (passage 2 or earlier), which corresponded to approximately six or fewer total population doublings.
Representative samples of each cell population were evaluated for multilineage developmental plasticity using in vitro assays well described in the literature [1, 5, 20]. Differentiation along the adipogenic, osteogenic, and neurogenic lineages was assessed qualitatively based on cell morphology, histochemistry (Oil Red O or von Kossa stain), or immunohistochemistry (TUJ1).
Gene Array Analysis
Total RNA was isolated from 1.6x106 adipo-derived stromal cells obtained from each of three separate donors (age 3047 years; mean 40 years). The RNA was isolated using the UltraSpec-II RNA Kit (Biotecx Laboratories, Inc., Houston, TX; http://www.biotecx.com/), according to manufacturers instructions. RNA was measured by spectroscopy with an A260/A280 ratio of 1:8. Isolated RNA was used to evaluate the transcription profile of a variety of angiogenic and extracellular matrix factors within each donor cell population using commercially available gene arrays (SuperArray Bioscience Corp., Bethesda, MD; http://www.superarray.com/). RNA was standardized among patients and samples by concentration. The gene array assays were performed according to manufacturers instructions. Briefly, biotinylated cDNA probes were generated from 3.92µg of total RNA using gene-specific sets of primers for reverse transcription. The cDNA probes were then hybridized with gene-specific cDNA fragments and spotted on nylon membranes overnight at 68°C. After washing, the arrays were exposed to X-ray film and visualized by autoradiography. The relative expression level of each gene was analyzed using the GE Array Analyzer (Super Array Bioscience). Each array included several positive controls (cyclophilin-A, ß-actin) and a bacterial plasmid (PUC18) as a negative control. A gene was considered to be expressed if its relative expression was greater than that of the negative control PUC18, which served as a proxy measure for background signal. Results were checked against gross evaluation of the X-ray film. Expression levels of select genes were then calculated relative to the positive control gene cyclophilin-A, which had the lowest expression threshold of all of the positive controls.
Flow Cytometry
Early passage cells from seven different donors (age 3054 years; mean 38 years) were evaluated for cell surface protein expression using flow cytometry. Three of these donors corresponded to the three samples evaluated by gene array.
Flow cytometry was performed on a Becton, Dickinson FACS Calibur (Franklin Lakes, NJ, http://www.bd.com/) using a 488-nm argon-ion laser for excitation; fluorescence emission was collected using 530/30 nm (FL1) and 585/42 (FL2) bandpass filters and logarithmic amplification. Cells were released with trypsin-EDTA and resuspended in DMEM/F12. The cells were then centrifuged and resuspended in wash flow buffer at a concentration of 1 x 106 cells/ml. Wash flow buffer consisted of phosphate buffer supplemented with 2% (v/v) FBS (Sigma) and 0.1% (w/v) sodium azide, NaN3 (Sigma). Cell viability was > 98% by the Trypan Blue dye (Gibco) exclusion technique. About 35 x 105 cells were stained with saturating concentrations of phycoerythrin (PE)conjugated antibodies and isotype-matched controls. The cells were incubated in the dark for 30 minutes at 40°C. After incubation, cells were washed three times with wash flow buffer and resuspended in 0.25 ml of cold, protein-free phosphate-buffered solution (PBS) with 0.25 ml cold formaldehyde (2%) solution to preserve.
Flow cytometer instruments were set using unstained cells. Cells were gated by forward versus side scatter to eliminate debris. Since highly autofluorescent cells can overlap with cells expressing low levels of an antigen, the sensitivity of the PE signal was increased by eliminating the autofluorescence signal out of the FL1 channel and thereby removing the contribution of autofluorescence in the measurement channel. A region (R2) was established to define positive PE fluorescence using a PE-conjugated isotype-matched control (Fig. 1
). The number of cells staining positive for a given marker was determined by the percentage of cells present within a gate established such that fewer than 2% of the positive events measured represented nonspecific binding by the PE-conjugated isotype-matched control (Fig. 1
). A minimum of 10,000 events was counted for each analysis.
|
Reverse Transcription Polymerase Chain Reaction (RT-PCR)
Human ADAS cells were analyzed for telomerase and ABCG2 using RT-PCR techniques. Telomerase RT-PCR was performed with a Telomerase PCR Kit (Roche, cat. no. 1854666) according to manufacturers instructions using a Bio-Rad iCycler PCR machine and a UVMax Kinetic Microplate Reader. Hela cells were used as positive controls, and Hela cells with Rnase were used as negative controls. A total of eight hADAS cell samples were tested.
Human ADAS cells from four patients were also screened for ABCG2 gene expression by RT-PCR. Confluent plates of hADAS cells were washed with PBS to remove debris and media. RNA was extracted from washed plates with adherent cells using an RNA extraction kit (Biotecx) per manufacturers instructions. Briefly, cells were lysed in Ultraspec reagent. Equal volumes of chloroform were added and allowed to sit at 4°C for 15 minutes. The mixture was centrifuged at 14,000 G for 15 minutes. The top aqueous layer was removed and placed into a new tube. An equal volume of isopropyl alcohol was added and vortexed. RNA-Tack resin was added to bind free RNA in solution. Resin was vortexed, centrifuged into a pellet, washed with 70% ethyl alcohol (EtOH) twice, and then dried. Resin was resuspended in water to release bound RNA. The A260:280 ratio was obtained to determine quantity and purity. RNA was then converted to cDNA through reverse transcription using these reagent volumes in a 20-mL reaction volume: 1x 1st strand buffer; 0.5 mL RNasin (ribonuclease inhibitor); 0.5 mg poly-T primer; 2 mg bovine serum albumin (BSA); 1 mM dithiothreitol (DTT); 500 nM deoxynucleotide triphosphates (dNTPs); 50 U SuperScript II; and 1 mg mRNA. Reaction conditions were 10 minutes at 23°C, 60 minutes at 42°C, and 10 minutes at 94°C.
The synthesized cDNA was used to perform PCR to determine the presence or absence of ABCG2 transcripts. PCR was carried out using a BioRad iCycler PCR machine. The reaction mixture consisted of Invitrogen QPCR master mix (3 mM Mg2+), SYBR Green, fluorescein, appropriate forward and reverse primers (500 nM each), deionized water (H2O), and 5mLcDNA. ABCG2 gene sequences used were forward primer (21-mer) 916 tcttctccattcatcagcctc 936, and reverse primer (21-mer) 1281 tcttcttcttcttctcacccc 1261, with an expected product of 366 bp. The A549 cell line was used as a positive control.
| RESULTS |
|---|
|
|
|---|
Gene Array Analysis
Transcriptional characterization of three different hADAS cell populations was performed using microarrays for human extracellular matrix or adhesion molecules (Super-Array, cat. no. HS-010N) and human angiogenesis-related factors (cat. no. HS-009N). A representative array result is shown in Figure 2
. Expected results were observed for internal controls on each array. Out of a total of 172 unique genes screened, only 7 genes were not transcribed by any of the hADAS cell populations. These unexpressed genes include the integrins
L,
M, ß6, ß7, selectin-L, and selectin-P and the apoptosis-related cysteine protease caspase 9. Of the 165 genes transcribed by at least one population, 114 (69%) were unanimously transcribed by all three hADAS cell populations, and a total of 143 (87%) were transcribed by at least two of the three populations (Table 2
; Fig. 3
). Some of the most highly transcribed genes include endoglin; FGFs 2, 6, and 7; FGF receptor 3; neuropilin-1; integrins
5 and
11; integrin ß1; TGF-ß receptors 2 and 3; SPARC (osteonectin); osteopontin; fibronectin-1; VEGF-D; TNF-
; and (MMP2) gelatinase A (Table 2
). Twenty-two (13%) of the transcribed genes were transcribed by only one hADAS cell population, and all correspond to a single donor (see "Patient A," Fig. 3
).
|
|
|
5/VLA-5), CD51 (integrin
V), and CD90 (Thy-1). Proteins that showed a positive, but more variable, expression across the seven donor groups include CD49b (integrin
2/VLA-2), CD49d (integrin
4/VLA-4), CD61 (integrin ß3), CD138 (syndecan-1), and CD140a (PDGFR-ß). The remainder of screened proteins were consistently absent or expressed on only negligible numbers of cells, including HLA-DR, CD4, CD8a, CD11a (integrin
L), CD11b (integrin
M), CD11c (integrin
X), CD18 (integrin ß2), CD41a (gpIIb), CD49f (integrin ß6/VLA-6), CD62L (L-selectin), CD62P (P-selectin), CD106 (VCAM-1), CD117 (c-kit), CD133, CD243 (MDR-1), and ABCG2 (Table 3
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Early-passage, undifferentiated hADAS cells transcribe a wide variety of genes related to angiogenesis and the extracellular matrix. Only 7 of 172 genes evaluated were not transcribed by any of the hADAS populations. Of the 165 genes that were transcribed by hADAS cells, 22 (13%) were transcribed by only one of the three populations evaluated. Most of these single-population transcripts include various integrins and matrix metalloproteinases (Fig. 3
). Most of our transcriptional data, however, suggests a high degree of consistency between cell populations isolated from different donors. For example, 143 (87%) out of a total 165 genes were transcribed by at least two of the three populations, and over two-thirds of these (69%) were transcribed unanimously by all three populations. Most of these transcripts and genes can easily be characterized as those consistent with primitive mesenchymal cells and include various growth factors and receptors, as well as integrins, extracellular matrix (ECM) proteins, and proteases, all of which are implicated in inflammation, matrix remodeling, angiogenesis, embryogenesis, organogenesis, tissue repair, and wound healing.
Of the 114 genes unanimously transcribed by early-passage, undifferentiated hADAS cells, those with the highest transcription levels include endoglin; FGFs 2, 6, and 7; FGF receptor 3; neuropilin-1; integrins
5 and
11; integrin ß1; TGF-ß receptors 2 and 3; SPARC (osteonectin); osteopontin; fibronectin-1; VEGF-D; TNF-
; and (MMP2) gelatinase A (Table 2
). Expression levels were calculated relative to the positive control gene cyclophilin-A, with levels ranging from one to four times the level of cyclophilin-A. As a reference, Silva et al. [22] demonstrated that cyclophilin-A is the 15th most abundant transcript found in human marrow-derived stromal cells. In fact, many of the genes we found to be highly transcribed by hADAS cells are identical to the most abundant transcripts detected in human marrow-derived stromal cells [9, 22]. For example, SPARC, MMP 2, TIMP 1 and 3, fibronectin-1, integrin
V, integrin ß1, and TGF-ß are all highly abundant transcripts found in human marrow-derived stromal cells, as well as hADAS cells. Though limited to only 172 genes, our gene array data suggest a reproducible and consistent molecular profile among hADAS populations derived from different donors, as well as notable similarities to marrow-derived stromal cells.
This study also analyzed hADAS cells for the expression of over 24 cell surface proteins using flow cytometry. As summarized in Table 3
, hADAS cell populations (n = 7) expressed these cell surface proteins in three general patterns: (a) those expressed by nearly all cells (>95%), (b) those expressed by minimal cells (<5%), and (c) those expressed by widely variable numbers of cells between these two extremes. Based on the proteins evaluated in this study, hADAS cells have a predominantly consistent and reproducible expression pattern of cell surface markers. Those that display variable expression patterns between populations (CD49b, CD49d, CD61, CD138, and CD140a) may reflect rapidly adapting cell responses to a dynamic extracellular milieu that is influenced by factors such as cell density, cell cycle, and time in culture.
Of note, the hADAS cell surface profile in this study corresponds excellently with published results from other groups. This is especially true on a qualitative level, and remains predominantly so when quantitative comparisons are made (Table 4
) [2, 11, 12, 23]. In conjunction with our own internal population-to-population reproducibility, this uniformity with other groups results suggests that adipose-derived stromal cell populations isolated on the basis of adherence to tissue culture plastic are perhaps more consistent and reproducible than has been recognized previously. This is particularly reassuring, given differences in nomenclature, subtle differences in cell isolation and culture, and differences in the materials and methods used for characterization between various groups. For example, the cells used in this study remained in culture twice as long before initial passaging as those used by Gronthos et al. [11], and subsequent passages were plated at a density of 2,000 cells/cm2 as compared to 10,000 cells/cm2. In addition, Gronthos et al. used cryopreserved cells for some of their assays, whereas this study did not.
|
Just as hADAS cells have many similarities with MSCs on a transcriptional level, they are also quite similar on a cell surface protein level. As summarized in Table 4
, when compared with published reports for MSCs, hADAS cells share a great majority of cell surface expression patterns, at least from a qualitative perspective. Our data do suggest a few differences (such as CD49d, CD62L, and CD106), which are consistent with reports from other groups [2, 11, 12]. However, these same markers have been a source of discrepant findings within the MSC literature itself [2628]. Without quantitative parameters, however, it is hard to assess the extent and significance of such differences. Nevertheless, the current transcriptional and cell surface profile of hADAS cells is strikingly similar to adherent stromal cells derived from the bone marrow (i.e., MSCs). Moreover, published reports of developmental plasticity are undeniably similar between the two groups of cells. Further work is necessary to delineate the extent and significance of any differences that exist between these two cell types and tissue sources.
Many of the CD markers that were screened in this study by flow cytometry were chosen to correlate with adhesion molecule genes evaluated by gene array. Results of this dual-level evaluation of these particular factors are summarized in Table 3
. In addition, some of the proteins evaluated in this study were chosen because of their correlation to "stemness" in other stem cell populations. For example, CD133 is associated with the prospective identification and isolation of hematopoietic stem cells (HSCs) [18, 29, 30]. As noted in Table 3
, CD133 was detected on minimal, if any, hADAS cells from the seven populations tested in this study. Similarly, ABCG2 is a member of the ATP binding cassette (ABC) superfamily of membrane transporters whose expression has recently been shown to be a conserved feature of stem cells from a wide variety of sources. It has recently been shown to confer the side-population phenotype which correlates with a stem cell population within bone marrow specimens [16, 17, 21, 31]. Forced expression of ABCG2 directly confers a stem celllike phenotype to bone marrow cells; and, like telomerase, ABCG2 expression is downregulated with differentiation. For these reasons, ABCG2 has been postulated as a molecular marker of stem cell phenotype. Our results demonstrate that this putative stem cell marker is not expressed on the surface of hADAS cells. Because the number of cells anticipated to express this marker is extremely low, and because our flow data ambiguously fit into this potential range, we confirmed our flow results with RT-PCR. The flow and PCR results together suggest that hADAS cells do not express the ABCG2 protein (Table 3
; Fig. 5
).
Finally, our findings suggest that hADAS cells do not express the ribonucleoprotein telomerase, as determined by RT-PCR (data not shown). Telomerase prevents telomeric shortening and correlates with extended replicative capacity in certain tumor cells and stem cells, and its expression correlates to the undifferentiated state [13, 15, 32]. Our negative findings, however, are similar to recent work that demonstrates a lack or absence of telomerase in cell populations that are otherwise considered stem cell candidates [33, 34].
| SUMMARY |
|---|
|
|
|---|
5,
11, and ß1. Our findings suggest remarkably good consistency in the transcriptional profile of hADAS cells isolated from different donors, as well as many similarities with published profiles for marrow-derived stromal cells. This study also confirms and expands on the cell surface profile of hADAS cells and confirms many cell surface similarities with marrow-derived stromal cells. More specifically, our results demonstrate good donor-to-donor consistency and reproducibility, both internally and when compared to previously published data from other groups. This uniformity is remarkable, given the inconsistent nomenclature and nonstandardized cell isolation and culture protocols. Of note, emerging evidence suggests that both adherence to plastic and time in culture appear to alter the cell surface phenotype. Our findings support the notion that adipose-derived stromal cells isolated by adherence to tissue culture plastic have a remarkably consistent molecular and cell surface profile, yet lack an easily definable phenotype. In the near future, it is hoped that a consensus on nomenclature and hADAS cell isolation and culture protocols will emerge, so as to allow more efficient and meaningful communication and interpretation of published research. Continued characterization of these cells will also help clarify phenotypic, developmental, and regenerative differences between them and freshly isolated SVF cells, and it may ultimately enable the prospective isolation of specific, purified subpopulations of putative multipotential stem cells and lineage-committed progenitor cells.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
This work was supported by the NIH (R21 HL 72141 and R21 DE 15023), by the Amercian Association of Plastic Surgeons Research Fellowship Award, and by a personal gift of Dr. and Mrs. Peyton Weary.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. J. Amos, H. Shang, A. M. Bailey, A. Taylor, A. J. Katz, and S. M. Peirce IFATS Collection: The Role of Human Adipose-Derived Stromal Cells in Inflammatory Microvascular Remodeling and Evidence of a Perivascular Phenotype Stem Cells, October 1, 2008; 26(10): 2682 - 2690. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Rebelatto, A. M. Aguiar, M. P. Moretao, A. C. Senegaglia, P. Hansen, F. Barchiki, J. Oliveira, J. Martins, C. Kuligovski, F. Mansur, et al. Dissimilar Differentiation of Mesenchymal Stem Cells from Bone Marrow, Umbilical Cord Blood, and Adipose Tissue Experimental Biology and Medicine, July 1, 2008; 233(7): 901 - 913. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Baharvand, A. Fathi, D. van Hoof, and G. H. Salekdeh Concise Review: Trends in Stem Cell Proteomics Stem Cells, August 1, 2007; 25(8): 1888 - 1903. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Gimble, A. J. Katz, and B. A. Bunnell Adipose-Derived Stem Cells for Regenerative Medicine Circ. Res., May 11, 2007; 100(9): 1249 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schaffler and C. Buchler Concise Review: Adipose Tissue-Derived Stromal Cells--Basic and Clinical Implications for Novel Cell-Based Therapies Stem Cells, April 1, 2007; 25(4): 818 - 827. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Boquest, A. Noer, A. L. Sorensen, K. Vekterud, and P. Collas CpG Methylation Profiles of Endothelial Cell-Specific Gene Promoter Regions in Adipose Tissue Stem Cells Suggest Limited Differentiation Potential Toward the Endothelial Cell Lineage Stem Cells, April 1, 2007; 25(4): 852 - 861. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ghosh, Y. Lu, A. Katz, Y. Hu, and R. Li Tumor suppressor BRCA1 inhibits a breast cancer-associated promoter of the aromatase gene (CYP19) in human adipose stromal cells Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E246 - E252. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Meyerrose, D. A. De Ugarte, A. A. Hofling, P. E. Herrbrich, T. D. Cordonnier, L. D. Shultz, J. C. Eagon, L. Wirthlin, M. S. Sands, M. A. Hedrick, et al. In Vivo Distribution of Human Adipose-Derived Mesenchymal Stem Cells in Novel Xenotransplantation Models Stem Cells, January 1, 2007; 25(1): 220 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Noer, A. L. Sorensen, A. C. Boquest, and P. Collas Stable CpG Hypomethylation of Adipogenic Promoters in Freshly Isolated, Cultured, and Differentiated Mesenchymal Stem Cells from Adipose Tissue Mol. Biol. Cell, August 1, 2006; 17(8): 3543 - 3556. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Mitchell, K. McIntosh, S. Zvonic, S. Garrett, Z. E. Floyd, A. Kloster, Y. Di Halvorsen, R. W. Storms, B. Goh, G. Kilroy, et al. Immunophenotype of Human Adipose-Derived Cells: Temporal Changes in Stromal-Associated and Stem Cell-Associated Markers Stem Cells, February 1, 2006; 24(2): 376 - 385. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
