Stem Cells 2005;23:530-543
www.StemCells.com
© 2005 AlphaMed Press
JAK2/STAT3 Directs Cardiomyogenesis Within Murine Embryonic Stem Cells In Vitro
Kara Foshaya,
Gisella Rodrigueza,
Bonnie Hoela,
Jonathon Narayanb,
G. Ian Gallicanoa
a Department of Cell Biology, Georgetown University Medical Center, Washington, DC, USA;
b Thomas Jefferson School of Technology, Alexandria, VA, USA
Key Words. Embryonic stem cells • Cardiac development • Signal transduction • JAK2/STAT3
Correspondence: G. Ian Gallicano, Ph.D., Georgetown University Medical Institute, Department of Cell Biology, 3900 Reservoir Road NW, Room NE203, Washington, DC 20007, USA. Telephone: 202-687-0228; Fax: 202-687-1823; e-mail: gig{at}georgetown.edu
 |
ABSTRACT
|
|---|
The heart is the first organ to form during development; however, little is known about the mechanisms that control the initial stages of cardiac differentiation. To investigate this process, we used a protein kinase expression screen, in which nonbeating embryonic stem (ES) cells were compared with beating ES cellderived cardiomyocytes. We found that JAK2 experienced a 70% increase in protein levels within beating areas. Inhibition of JAK2 pharmacologically or by using dominant/negative JAK2 both resulted in diminished beating within embryoid bodies (EBs), whereas gain of function analysis using dominant/positive JAK2 resulted in a significant induction of beating. More important, inhibition of STAT3, a specific target of JAK2, by dominant/negative STAT3 resulted in the virtual complete loss of beating areas. Reverse transcriptionpolymerase chain reaction and Western analysis of STAT3-inhibited EBs resulted in lack of expression of several cardiac-specific genes, many of which contain within their promoter STAT3 DNA-binding regions. Taken together, the data reveal that the JAK2/STAT3 pathway is essential for initial stages of cardiomyogenesis.
 |
INTRODUCTION
|
|---|
The first organ to form in mammals is the heart. In murine development, at approximately E7.5 to E8.0, distinct mesodermal cells form bilateral cardiac progenitor cells that proceed to fuse and form a primitive heart tube [1]. During tube formation, distinctive beating of cardiac cells within the developing heart begins at approximately E8.0 [2]. Although overall molecular control of heart tube morphogenesis has been investigated in great detail both in vivo and in vitro, few investigations exist with regard to the initial regulatory mechanisms that differentiate progenitor cells into beating cardiomyocytes. Some obvious reasons for this lack of information have been the difficulty of procuring mammalian embryos at precardiomyocyte stages as well as the difficulty in analyzing the few cardiomyocytes available from early heart tubes. Recently, however, a cardiac in vitro model system was developed using embryonic stem (ES) cells. Manipulating ES cells to form embryoid bodies (EBs) that consistently give rise to beating cardiomyocytes has been shown to be relatively straight-forward and highly reproducible [38]. More important, the electrophysiology of these beating cells has been documented and verified as closely mimicking cardiomyocyte electrophysiology [9].
To determine the signal transduction pathways that drive cardiomyocyte differentiation, we subjected lysates from beating and nonbeating areas of EBs (procured using a microsurgical protocol similar to the one we previously described [8]) to a kinase expression screen. Out of 75 kinases tested, JAK2 demonstrated the highest level of expression (>70%) within beating ES-derived cardiomyocytes compared with nonbeating ES cells.
JAK2 is a member of the Janus kinase family, which includes JAK1-3 and TYK2. A primary function of these kinases is to regulate gene transcription by phosphorylating a family of transcription factors called signal transducers and activators of transcription (STATs). Seven STAT family members exist, all of which have been investigated in many in vitro and in vivo systems, including knockout mouse models [1017]. Members of this signal transduction pathway have been implicated as a major constituent of adult cardiac pathophysiology, including pressure overloadinduced cardiac hypertrophy [18, 19], increased sensitivity to inflammation, cardiac fibrosis, and heart failure [20], as well as a paradoxical cardioprotection by ischemic preconditioning and cardiac dysfunction induced by ischemia/reperfusion [2125].
The conventional knockout of JAK2 resulted in embryonic lethality at embryonic days 1112 (E11E12) due to a significant reduction in erythropoiesis [26, 27]. Also observed was a significant delay in heart morphogenesis [27], but this phenotype was not explored in depth in those knockout embryos.
Ablation of STAT3 in mice led to embryonic lethality at E6.5E7.0, which is, coincidentally, immediately before cardiomyocyte formation [28]. Moreover, the heart-specific STAT3 knockouts produced by conventional cre/lox technology led to higher susceptibility to heart failure in juvenile mice [20]. It must be noted, however, that STAT3 was not analyzed during cardiomyocyte differentiation in the study by Jacoby et al. [20] because the cre in the heart-specific knockout was driven by the
-myosin heavy chain promoter, which is expressed at low levels before birth, followed by higher levels long after cardiomyocyte differentiation.
Consequently, based on our kinase expression screen implicating JAK2, the JAK2/STAT3 knockout data [2628], and the evidence that JAK2/STAT3 is clearly involved in remodeling diseased adult cardiomyocytes, we hypothesized that distinct regulation of specific components must occur during initial modeling of cardiac progenitor cells, driving them down the cardiomyocyte differentiation pathway.
To test this hypothesis, specific stages of EB differentiation were analyzed by using highly specific molecular, biochemical, pharmacological, and microscopic analyses. We found that the JAK2/STAT3 pathway is essential for proper gene expression and development of beating cardiomyocytes from ES cells.
 |
MATERIALS AND METHODS
|
|---|
ES Cell Culture and Production of Cardiomyocytes
CCE ES cells were grown on 0.1% gelatin in Dulbeccos modified Eagles medium (DMEM) medium containing 15% fetal bovine serum (FBS), 1 x nonessential amino acids, 2.0 mM glutamine, 1,000 U/ml leukemia inhibitory factor (LIF), and 100 µM 2-mer-captoethanol. This medium inhibits differentiation of ES cells and is used until differentiation is induced. For differentiation of ES cells, EBs were generated by culture in suspension for 5 days, followed by further differentiation by plating in 24-well plates in the medium described above without LIF.
Reagents
AG490 and AG897 were purchased from Biomol Inc. (Plymouth Meeting, PA). Each inhibitor was dissolved in dimethyl sulfoxide (DMSO) at x 100 to 1,000 immediately before use. Unused inhibitor was aliquoted and stored at 80°C. Antibodies against JAK2 and each STAT and phosphorylated JAK2 and STAT3 were purchased from American Research Products (ARP Inc., Belmont, MA) and Upstate Biochemicals (Charlottesville, VA). Antibodies to tubulin and cardiac actin were purchased from Sigma Inc. (St. Louis). Antibodies against Nkx2.5 and GATA-4 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
Confocal Microscopy
Confocal analysis was conducted on beating and nonbeating areas from EBs isolated using microdissection techniques as described by Zhou et al. [8]. Areas were fixed in 4% paraformaldehyde for 1 hour, followed by permeabilization with 1% Triton-X-100 for 30 minutes. After two washes in phosphate-buffered saline (PBS), areas were blocked with a protein mixture from the M.O.M. Kit from Vector Laboratories, Inc. (Burlingame, CA). Primary and secondary antibodies were diluted in blocking solution, and areas were incubated with each antibody for 1 hour at 37°C. In the final step, areas were moved directly from secondary antibody into a DAPI solution at 2 µg/mL. Areas were then mounted onto slides with antifade and sealed with coverslips.
Confocal images of were taken on an Olympus Fluoview 500 Laser Scanning Microscope (Olympus America Inc., Melville, NY) using the accompanying Fluoview image acquisition and analysis software (version 4.3). Cells within areas were imaged using a 1.4 numerical aperture, x60 Olympus objective.
Reverse TranscriptionPolymerase Chain Reaction
Reverse transcriptionpolymerase chain reaction (RT-PCR) for EBs was performed similarly to Zhou et al. [8]. RNA was isolated from beating or nonbeating areas from EBs using the RNAeasy kit from Qiagen (Valencia, CA). RT reactions were carried out, in 50-µl reactions, using the Invitrogen One-Step RT-PCR kit (Carlsbad, CA). The following parameters were used: RT reaction was carried out at 50°C for 30 minutes, 35 to 40 cycles of cDNA synthesis at 94°C for 30 seconds, 58°C to 60°C for 30 seconds, and 72°C for 1 minute. Three control reactions were run for each batch of mRNA [8]. First, no RT was used in concurrent reactions to determine if contaminating DNA was present. Second, when possible, primers were generated from two different exons. The rationale for this approach is that amplification of contaminating genomic DNA would result in a PCR product with a molecular weight much higher than a PCR product amplified from cDNA because intronic sequences would be included in the amplification. Third, tubulin primers were used as a positive control for all PCR reactions.
STAT3 and STAT3ß sequences differ by a 50-bp deletion. Thus, primer sequences were generated from either side of this area so that the primers could detect and differentiate between STAT3 and STAT3ß. Primer sequences for STAT3F1 and STAT3R1 were obtained from Caldenhoven et al. [29]. Sequences for nested STAT3 primers are as follows: STAT3F3 GCCCCATACCTGAAGACCAAGTT; STAT3R2 CAGCA-CATTCACCATTATTTCC. Primer sequences for analysis of the JAK2KE dominant/negative (dom/neg) construct are JAK2F5 TTCGGGAGTGTGGAGATGT; Jak2R6 CTGTAG-CACACTCCCTTC.
A Super Array RT-PCR kit was purchased from Super Array Bioscience Corporation (Frederick, MD). This kit included primers to the mouse genes for C/EBP
, ß, and
; MyoD; Tnnt2; Tnnc; Nkx2.5; cardiac actin; dihydropyridine (DHP) receptor (also termed L-type Ca2+ channel
2 subunit); and GAPDH. cDNAs were synthesized from each RNA sample using the Invitrogen First Strand Synthesis Kit. Samples were then subjected to RT-PCR using the premixed primer/buffer/RT mix for each gene. Products, which ranged in size from 100700 bp, were visualized on a 2% agarose gel containing ethidium bromide. These analyses were repeated three times.
Semiquantitative RT-PCR analysis was carried out on samples from the Super Array kit. GAPDH was amplified from RNA samples for 25, 30, and 35 cycles and then run on a gel. This ensured that at 30 cycles, the amplification was still in the linear range. Then 10 µl of RT-PCR product for each sample was loaded onto the gel and normalized to tubulin.
Western Blot Analysis
Western Blot analysis was performed similarly to Zhou et al. [8]. Isolated beating and nonbeating areas were placed in sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS wt/vol, 1 mM ß-mercaptoethanol, 10% glycerol), sonicated, and then denatured by boiling for 5 minutes. Samples were electrophoresed on SDS-polyacrilamide gels with molecular-weight markers. After the proteins were transferred to polyvinylidene difluoride membranes and blocked with blotto (5% dry mild in PBS with 0.1% Tween 20, pH 7.4), the blots were incubated with primary antibody at 1/500 and 1/1,000 dilutions at 4°C overnight. The membranes were then washed three times with PBT (1 x PBS + 0.1% Tween 20) and incubated with secondary antibody conjugated to horseradish peroxidase (Pierce Inc., Rockford, IL). Each Western blot was repeated approximately three times.
Stable Transfection of ES Cells
Prk5 plasmid vectors containing constructs for JAK2 dom/neg (JAK2 K-E) and JAK2 dominant/positive (dom/pos) (JAK2 D4) were kindly provided by Dr. James Ihle. The PSG513 plasmid containing the Stat3ß construct was a gift from Dr. Richard Jove. Each plasmid was transformed into DH5
competent cells (Invitrogen) and purified using the Qiagen miniprep kit. The plasmids were linearized using an appropriate restriction enzyme and purified by phenol-chloroform extraction and ethanol precipitation.
Confluent CCE cells were trypsinized and resuspended in 5 ml knockout DMEM (Invitrogen) without serum. For each plasmid, 1 ml of cells was added to 30 µg of linearized DNA and a ptkNEO construct and allowed to incubate for 5 minutes. Cells were then electroporated at 250 V and immediately placed on ice. The electroporated cells were plated and grown in knockout DMEM with 15% FBS and G418 (400 µg/mL) to select for cells containing the plasmid. After 1 week, individual colonies growing in the presence of G418 were picked, trypsinized, and replated. Presence of the gene of interest was confirmed by PCR.
Analysis of STAT3ß clones by Western blot identified low, medium, and high expressers when normalized to tubulin. Experiments with transfected cells were performed with at least six different clones.
The JAK2 KE construct, which was made by mutating amino acid 882 from K to E, acts as a dom/neg form of JAK2. Because the construct was designed using the mouse JAK2 nucleotide sequence and our ES cells are from mouse, we were not able to use Western blotting techniques to distinguish between expression of wild-type and dom/neg JAK2. However, the K to E mutation disrupted an MboII restriction site, which allowed us to use RT-PCR to detect both forms of JAK2, followed by a restriction digest resulting in digestion of each form differentially. The RT-PCR produced a 179-bp product (primer sequences: 5'TTCGGGAGTGTGGAGATGT and 3'CTGTAG-CACACTCCCTTC). PCR product 20 µL was digested without purification using the restriction enzyme MboII. Wild-type JAK2 was cleaved into three fragments of 22, 78, and 79 bp. The two larger bands appear as one on the gel. The dom/neg JAK2 yielded two fragments of 100 and 79 bp.
Statistical Analysis
Experimental groups were replicated at least three times. For display of data, each point on a graph represents a mean ± standard error of the mean (error bars) for an experimental group or observation. Analysis of variance statistical software was used to determine statistical difference between experimental groups.
 |
RESULTS
|
|---|
JAK2 Expression and Activity Is Elevated in Beating Areas
Comprehensive analysis of beating and nonbeating areas from CCE EBs was determined molecularly by RT-PCR using primers specific for cardiac genes (data not shown; see [8] for similar results in EBs derived from R1 ES cells). Beating areas always expressed all cardiac-specific genes tested, whereas expression of cardiac-specific genes from nonbeating areas was highly variable [8]. The raw data from our proteomic screen (Kinexus Inc., Vancouver, Canada) revealed a dramatic increase of JAK2 in beating areas compared with nonbeating areas (Figs. 1AC
). Western blot analyses in our laboratory verified the kinase expression data from the Kinexus Inc. proteomics report (Fig. 1D
).

View larger version (52K):
[in this window]
[in a new window]
|
Figure 1. Graphs show raw and normalized data taken directly from the Kinexus protein kinase screen. (A): Kinexus Inc. (http://www.kinexus.ca/) uses a highly sensitive imaging system with a 16-bit camera (Bio-Rad Fluor-S Max Multi-Imager) in combination with quantitation software (Bio-Rad Quantity One) to quantify and analyze the chemiluminescent samples. The resulting trace quantity for each band scanned at the maximum scan time is termed the raw data. Because the relationship between scan time and band intensity is linear over the quantifiable range of the signal intensity, the raw data from the scans are normalized to 60 seconds (counts per minute [CPM]) for uniformity. (B):. After normalization, data are converted to percentages by subtracting the control (nonbeating) normalized CPM from the experimental (beating) normalized CPM, followed by dividing the difference by the control (nonbeating) normalized CPM and multiplying by 100. (C): The actual JAK2 bands from the Kinexus report show a stronger signal in beating areas compared with nonbeating areas. The red lines in (C) are generated and used by the computer to find the correct bands. (D): Our follow-up Western confirmed the Kinexus data. A ratio of JAK2 protein levels was calculated by normalizing to tubulin (from the same blot), showing that there is 1.6 times (65%) more JAK2 in beating areas than nonbeating areas. (E, F): Confocal microscopy of EBs showed higher levels of JAK2 in beating areas, represented by (F) anticardiac troponin, compared with nonbeating areas subjected to anti-JAK2. Arrows point to JAK2 on cell membranes. (G): Confocal microscopy of EBs clearly showed high amounts of activated pJAK2 on membranes (arrows) in cardiac troponinpositive cells. (H): Western blot shows clear increase in active JAK2 by two times in beating areas. Hela cells serve as a positive control. Scale bar in (E) = 25 µm. Abbreviations: B, beating; NB, nonbeating.
|
|
JAK2 localization in beating areas was additionally resolved using confocal microscopy. Antibodies directed against JAK2 or its physiologically active counterpart, phosphorylated JAK2 (pJAK2) [30], followed by fluorescently labeled secondary antibodies, resulted in a strong, highly specific signal in cells residing in beating areas (Figs. 1EG
). Confocal microscopy clearly showed distinct staining for JAK2 and pJAK2 on or near the plasma membrane in newly differentiated, cardiac troponin T (Tnnt2)positive, beating cardiomyocytes (~1218 hours after onset of beating; Figs. 1EG
) [8]. This high level of staining at or near the membrane was rarely seen in cells residing in nonbeating areas. Some areas that were clearly not beating occasionally stained brightly for JAK2; however, the staining pattern in most of these cells was diffuse and cytoplasmic. pJAK2 also was occasionally observed in nonbeating areas (Figs. 1EG
). Western blot analysis supported our confocal data, because pJAK2 was found to be highly elevated in beating areas compared with nonbeating areas (Fig. 1H
), additionally supporting the fact that JAK2 was indeed active in beating areas.
JAK2 Inhibition and Activation Alters Cardiomyocyte Differentiation
To determine the physiological relevance of JAK2 during cardiomyogenesis, we first inhibited JAK2 function using the relatively specific pharmacological agent to JAK2, AG490. EBs were subjected to medium containing various concentrations of AG490, including a concentration known to be specific for JAK2. Addition of AG490 before beating significantly decreased the number of EBs containing at least one beating area compared with controls (Fig. 2A
). Control EBs (DMSO treated and untreated) always showed over time a gradual increase in the number of EBs that had at least one beating area. Usually by day 7 after plating, 75%95% of the control EBs contained at least one beating area. However, in a dose-dependent manner, AG490 significantly (p < .05) inhibited cardiomyocyte differentiation through JAK2 as measured by STAT3 phosphorylation and beating morphology (Fig. 2A
). Addition of AG490 to the medium after beating had commenced showed no effect compared with control EBs (data not shown). Interestingly, beating was virtually wiped out when EBs were subjected to AG490 at levels (10 µM) that inhibit JAK2 and other kinases.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2. (A): Graph shows dosage affects of AG490 on ES cell differentiation into beating cardiomyocytes. On average for this experiment, approximately 20% of untreated and DMSO-treated control EBs began beating 7 days after plating, gradually rising each day until day 11, when the number of EBs beating plateaued at approximately 80%90%. In EBs subjected to AG490 at concentrations specific for JAK2 (5 µM) [53], beating was reduced by approximately 50% overall, whereas AG490 at 1/10 concentration (500 nM) resulted in only 20% fewer EBs beating compared with controls. At concentrations (10 µM) known to inhibit other kinases (e.g., phosphatidylinositol 3, unknowns), beating is virtually wiped out. Inset shows the state of phosphorylated STAT3 from ES cells pretreated with specific concentrations of AG490. Phosphorylation declines as AG490 increases. (B): Total number of beating foci were counted and averaged. Untreated control EBs on average had one beating foci per EB beginning 7 days after plating, followed by a trend upward to six to seven beating foci by day 12. AG879, a drug structurally similar to AG490 but not known to inhibit JAK2, also showed a similar trend as untreated controls. AG490-treated EBs, however, had on average 0.5 beating areas per EB. Data are from at least three separate experiments. All data are presented as mean ± standard error of the mean for all EBs treated at each time point. Shown in the inset of each figure is the value n = X number of EBs observed. Abbreviations: DMSO, dimethyl sulfoxide; EB, embryoid body; ES, embryonic stem.
|
|
Closer analysis of each differentiated EB revealed that the average number of beating areas was altered when treated with specific concentrations of AG490 (Fig. 2B
). As described previously [8], the entire EB rarely beats. Only distinct areas or foci differentiate into cardiomyocytes that beat at relatively constant rates for at least 1012 days. Although untreated control EBs and EBs subjected to AG897, an agent chemically similar to AG490 but not shown to inhibit JAK2, resulted in progressively more beating foci over time (Fig. 2B
), inhibition of JAK2 significantly decreased the average number of beating foci in EBs. Antagonizing JAK2 with AG490 did not affect beat rate in the few EBs that were beating. Controls and treated EBs all beat at an average of approximately 63 beats per minute (bpm); 62.3 ± 4.0 bpm for controls and 61 ± 3.0 bpm for AG490-treated EBs.
We confirmed these results and accumulated new data using dom/neg and dom/pos JAK2 constructs. Stable JAK2 dom/neg (provided by Dr. James Ihle) ES cell lines were generated by simultaneously electroporating a ptkNEO construct, followed by G418 selection (Fig. 3A
). In the loss-of-function analyses, JAK2 dom/neg expression (Fig. 3B
) resulted in a marked decrease over time in EBs that were beating compared with untreated or empty vector controls (75%98% at days 8 through 13). The average number of beating areas was also significantly (p < .05) decreased in dom/neg cell lines compared with control EBs (Fig. 3C
). An intriguing observation, however, was the fact that although inhibiting JAK2 resulted in fewer beating areas, many EBs were still capable of generating beating cardiomyocytes. Underlying reasons for these results may lie in one of two explanations: JAK2 dom/neg construct may not completely inhibit wild-type JAK2, or other compensatory mechanisms may come into play. The latter may provide an explanation as to why JAK2 knockout mice contain hearts, albeit with defects [26, 27].

View larger version (40K):
[in this window]
[in a new window]
|
Figure 3. (A): Stable expression of the JAK2 dom/neg construct (KE15) in ES cells was detected by RT-PCR. The Jak2 (KE15) construct was produced by mutating amino acid 882 from K to E. This mutation disrupted an MboII restriction site, which enabled detection of endogenous JAK2 and the KE15 construct using RT-PCR, which produced an endogenous 179-bp JAK2 product (primer sequences: 5'TTCGGGAGTGTG-GAGATGT and 3'CTGTAGCACACTCCCTTC). Using the restriction enzyme MboII, wild-type JAK2 PCR product was cleaved into three fragments of 22, 78, and 79 bp (two larger bands appear as one). Dom/neg JAK2 yielded two fragments of 100 and 79 bp. (B): Dom/neg JAK2 resulted in a 25%30% decrease in beating up to day 11. (C): Dom/neg JAK2 also significantly affected the number of beating foci per EB. By day 12, control (empty Neo cassette) EBs contained eight to nine beating foci per EB, whereas dom/neg JAK2-expressing EBs contained approximately three to four beating areas per EB. (D): Graph shows the effect of dom/pos JAK2 (D4). EBs transiently transfected with a D4 contained significantly more (p > .001, on average seven to eight) beating areas than GFP-transfected or untransfected EBs by day 7 after plating. This difference was maintained for at least 45 days. (E): Western blot shows expression of D4. No expression was seen in untransfected ES cell (ES) or beating EBs (B). D4 expression was observed with 1.0 and 1.5 µM cDNA. Stable lines (ad) rarely differentiated into cardiomyocytes. We attributed this result to perpetual activation of STAT3, which promoted ES cell self-renewal. Except where shown, n 48 for each data point. Abbreviations: dom/neg, dominant/negative; dom/pos, dominant/positive; EB, embryoid body; ES, embryonic stem; GFP, green fluorescent protein; RT-PCR, reverse transcriptionpolymerase chain reaction.
|
|
Equally intriguing were the gain-of-function data obtained from EBs expressing dom/pos JAK2. Based on the data thus far (Figs. 1
, 2
), if JAK2 was a critical component of cardiac differentiation, we expected to observe an increase in beating areas in EBs expressing dom/pos JAK2 compared with controls. In fact, we clearly observed almost all of the dom/pos EBs containing significantly (p < .05) more beating areas beginning as soon as 2 days after transient transfection of JAK2 dom/pos cDNA into EBs (Figs. 3DF
). Consequently, when the proteomics, confocal images, drug, and molecular data are taken together (and upon closer inspection of the images in JAK2 knockout mouse literature), JAK2 clearly seems to play a role in normal early cardiac development, although it is possible that other compensatory mechanisms (e.g., other JAKs SRC family members) [28] may substitute for or bypass JAK2 to eventually allow the heart to form (albeit delayed significantly and less efficiently) [27].
STAT3 Expression and Activity Is Elevated in Beating Areas
JAK2 phosphorylates STAT3, resulting in STAT3 translocation into the nucleus, where it acts as a transcription factor [14]. To determine whether STAT3 was directly involved in initial stages of cardiac differentiation, we first used confocal microscopy to follow STAT3 in beating and nonbeating areas within EBs (Figs. 4AI
). In beating, Tnnt2+ areas, distinctly higher levels of STAT3 staining were evident, including within nuclei (Figs. 4AC
); in contrast, STAT3 was detectable only at relatively low levels in most nonbeating, Tnnt2 areas.

View larger version (142K):
[in this window]
[in a new window]
|
Figure 4. Confocal microscopy reveals expression and activity of STAT3 in beating foci within embryoid bodies. (AC): STAT3 (Rhodamine; arrows in A) is elevated in beating cardiomyocytes derived from embryonic stem cells, as shown by anti-STAT3 antibodies. Arrows in (B) show cardiac troponin T (Tnnt2) staining (fluorescein isothiocyanate) representing cardiomyocyte differentiation in cells observed in (A). (C): DAPI staining reveals each nuclei within the field of view of (A, B). (DF): When phosphorylated on Y705, STAT3 translocates to the nucleus and becomes transcriptionally active. Using an antibody directed against Y705-phosphorylated STAT3, staining (red) was clearly observed within nuclei (arrowheads in D) of Tnnt2+ cells (green staining cells in E). Dual label of (E) anti-pSTAT3 and Tnnt2 revealed in more detail pSTAT3 residing within each cardiomyocyte nucleus (arrowheads). Nucleoli within each nucleus were devoid of pSTAT3 (thin arrows). (GH): Within a nonbeating area, arrowheads in (G, I) point to STAT3-free nuclei, whereas in (H), anti-Tnnt2 antibodies show no signal. Scale bar in (A) = 10 µm for AI.
|
|
To determine whether STAT3 was physiologically active, we used an antibody specific for the phosphorylated form of STAT3 (pSTAT3) [31]. In all cases, pSTAT3 was observed within the nucleus of Tnnt2+ cardiomyocytes (Figs. 4DF
), whereas only occasionally was it found in cells that did not stain for Tnnt2 or were not beating (Figs. 4GI
). Confocal data were confirmed by Western blot analysis of STAT3, which showed levels of STAT3 approximately threefold higher and active pSTAT3 approximately twofold higher in cells of beating areas compared with cells of nonbeating areas (Figs. 5A, 5B
).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 5. Western blots provided evidence confirming our confocal data. (A): STAT3 increased by close to three times in beating areas, whereas (B) pSTAT3 increased by at least two times. (C): Western blot shows that STAT3 is active in undifferentiated ES cells, as demonstrated by its phosphorylation. Phosphorylation levels drop beginning 2 days after inducing the differentiation process. (D): Phosphorylated STAT3 returns 5 days after plating EBs, when beating begins in wild-type EBs. By day 14, both EB beating and pSTAT3 are at their peak. Abbreviations: B, beating; EB, embryoid body; ES, embryonic stem; NB, nonbeating.
|
|
In the developing mouse embryo, migration of cardiomyocyte precursors begins at E6.5 and progresses quickly, with the commencement of beating at E8. Thus, in our in vitro model of this process, we expected to observe STAT3 activation (albeit at very low levels at first) occurring a few days before the onset of beating. To test this hypothesis, we followed our standard procedure for differentiating ES cells, taking protein samples from entire EBs each day during the differentiation process. Although we found detectable levels of STAT3 throughout differentiation, levels of pSTAT3 that were high in undifferentiated ES cells dropped dramatically as soon as day 2 of the differentiation process (Fig. 5C
). Interestingly, pSTAT3 levels were detectable again in EBs (entire EB tested) approximately 13 days before the average onset of beating within EBs (Fig. 5D
). This observation fit nicely with the known temporal activation of STAT3 compared with the onset of beating in vivo [2, 32].
STAT3 Inhibition Restricts Cardiomyocyte Differentiation
To determine the function of STAT3 in cardiomyocyte formation, we made stable ES lines expressing a STAT3 dom/neg construct (STAT3ß; Fig. 6A
) [29, 33]. EBs expressing high (clones 7A, 8B) and medium (clone 10D) levels of the STAT3ß resulted in only 12.0% ± 4.3% of EBs containing at least one beating area, an observation that lasted over 21 days after starting the differentiation process (up to day 12 graphed; Fig. 6B
). In contrast, control EBs (untreated and NEO stable lines) containing beating areas peaked at days 9 through 12 at approximately 95%, remaining at that level until day 21. Interestingly, low STAT3ß expression resulted in approximately 50%75% EBs containing at least one beating area (Fig. 4B
; ES line 8A). The fact that the average number of beating areas per EB (Fig. 6C
) and the rate at which they were beating were also significantly decreased by STAT3ß (Fig.6D
) strongly suggests that STAT3 is a key component in the cardiomyogenesis pathway.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 6. STAT3 function was analyzed molecularly using dominant/negative STAT3. (A): ES cell lines were electroporated STAT3ß and CMV Neo in a 10:1 ratio, followed by selection with G418 to produce STATß stable ES cell lines. STAT3ß is detectable as a smaller band than STAT3 by SDS-PAGE. Out of 10 clones, four revealed different levels of expression. Based on levels of expression attained by normalizing band density to endogenous STAT3, lines 7A and 8B were considered high expressers, whereas 10D was considered a medium expresser and 8A a low expresser. (B): Graph shows affects of STAT3ß expression on cardiomyocyte differentiation from ES cells. On average, approximately 25%30% of nonelectroporated or CMV neoelectroporated control EBs began beating 7 days after plating, gradually rising each day until day 11, when the number of EBs beating plateaued at approximately 80%90%. Only 15%16% of high and medium STAT3ß expressers showed signs of differentiation by day 12. The low expresser line (8A) resulted in significant decrease in differentiation (p > .001); however, significantly more EBs were found beating in line 8A than higher STAT3ß expressing lines. (C): Total number of beating foci were counted and averaged. Untreated control EBs on average had 2.5 ± 0.6 beating foci per EB 7 days after plating, followed by a trend upward to 5.8 ± 1.1 beating foci by day 12. Each ES cell line showed a significant decrease in beating areas per EB. (D): Beat rate also was affected depending on levels of expression, approximately 70 beats per minute in controls versus 20 to 22 beats per minute in the highest expressing lines. Data are from at least three separate experiments. All data are presented as mean ± standard error of the mean for all EBs treated at each time point. n 48 EBs observed for all data points. Abbreviations: CMV, cytomegalovirus; EB, embryoid body; ES, embryonic stem.
|
|
Upon closer inspection of wild-type ES cells analyzed by Western blots probed with STAT3 antibodies, we observed an endogenous band at approximately 83 kD appearing 23 days after inducing ES cells to differentiate (Fig. 7A
). This band was the same size as STAT3ß observed in our ES cell lines stably expressing STAT3ß (Fig. 6A
). RT-PCR analysis verified putative endogenous STAT3ß expression soon after EBs began to differentiate (2-day EB; Fig. 7B
). We used the four stable ES cell lines as positive controls, all of which showed STAT3ß expression. The STAT3ß band was not detected in undifferentiated EBs.

View larger version (62K):
[in this window]
[in a new window]
|
Figure 7. (A): Endogenous STAT3ß was detected 23 days after ES cells were processed for differentiation. STAT3ß fell below levels of detection at approximately day 6, a few days before the average onset of beating in EBs. (B): Reverse transcriptionpolymerase chain reaction of undifferentiated ES cells, EBs differentiated for 23 days (when the Western in A detected STAT3ß), and each stable ES cell line revealed that STAT3ß was indeed expressed endogenously early on in the differentiation process and in our ES cell lines. Abbreviations: EB, embryoid body; ES, embryonic stem.
|
|
STAT3 Inhibition Suppresses Key Cardiac Gene Expression
Finally, Western blot and RT-PCR analyses were used to resolve why our ES cell lines expressing exogenous STAT3ß were not completing their differentiation process (beating). Antibodies to alpha-cardiac actin, Nkx2.5, and GATA-4 were used as probes on nonbeating, beating, and STAT3ß-expressing ES lines. Although isolated beating areas were positive for all cardiac proteins tested, high- and medium-expressing STAT3ß ES lines (line 7A, 8B, and 10D) showed expression only for GATA-4. Low STAT3ß-expressing lines (line 8A) expressed cardiac markers, albeit at lower levels (Fig. 8
).
Semiquantitative RT-PCR confirmed our Western blot analyses and added new data as primers to Tnnt2, TnnC, Nkx2.5, cardiac actin, and
1 subunit of the L-type Ca2+ channel (DHP) were used to determine expression of possible downstream genes affected by the suppression of STAT3. Expression of specific cardiac genes was markedly lower in STAT3ß EBs differentiated for at least 710 days after plating (Fig. 8B
). Interestingly, promoter sequence analysis of the DHP gene, cardiac actin, and Nkx2.5 revealed putative STAT3 DNA binding sites, suggesting that STAT3ß inhibition of STAT3 could lower or even prevent expression of these cardiac genes (Table 1
).
Closer inspection of promoter regions for many cardiac genes revealed that DNA binding sites were common for the interleukin (IL)-6 acute-phase response gene C/EBP, which has been shown to be reliant on STAT3 for expression [34, 35]. Semiquantitative RT-PCR analysis of STAT3ß ES cell lines (lines 7A through 10D) revealed a loss or reduction in C/EBPß and
expression (Fig. 8C
). Table 1
summarizes cardiac genes with STAT3 or C/EBP regulatory elements. The fact that C/EBPß and
sites are found within many cardiac genes and that STAT3ß expression leads to the loss of these specific cardiac genes strongly suggests that expression of many cardiac genes is dependent on active STAT3 or C/EBP.
 |
CONCLUSION
|
|---|
The JAK/STAT pathway has been shown to partake in ES cell function primarily through LIF/GP130 by promoting ES cell maintenance and ES cell self-renewal [3638]. Differentiation has been shown to ensue in ES cells once LIF is removed from the medium and specific STATs, primarily STAT3, are downregulated [37, 38]. In this study, we show that STAT3 is positioned at a critical juncture during ES cell differentiation, distinctly regulating the cardiomyogenesis pathway. Furthermore, STAT3 activation is partly dependent on active JAK2 signaling.
To analyze the signal transduction mechanisms involved in differentiation, we performed a proteomics assay specific for kinase expression. Based on those data, it was clear that in beating cardiomyocytes differentiated from ES cells, the tyrosine kinase JAK2 was elevated in its expression by 70% compared with non-beating areas from the same EBs. Of 75 kinases we examined, the expression level for JAK2 was almost two times higher than any other kinase that also showed an increase in expression. Based on these initial data, we immediately speculated that JAK2 activity and the JAK/STAT pathway were necessary for differentiation of ES cells into beating cardiomyocytes. We tested this premise first by using a pharmacological approach incubating ES cells in AG490 either before or after beating occurred and second by using molecular dom/neg, dom/pos approaches. In a dose-dependent manner, EBs treated with AG490 before they began beating resulted in significantly fewer beating areas within EBs compared with controls. There also was a distinct window of time for AG490 to take full affect. If AG490 was added 2 or more days before beating normally occurred (measured by untreated controls), beating areas within EBs were significantly reduced compared with controls. Addition of AG490 anywhere within that 2-day period before beating resulted in highly variable results compared with controls. AG490 treatment after beating occurred did not show any difference compared with untreated EBs; that is, the number of beating areas and beating rates were similar. Stable expression of the dom/neg JAK2 produced results similar to our drug studies in that we consistently saw fewer EBs that were beating as well as fewer beating areas per EB compared with mock-transfected stable ES cell lines (controls).
Transient transfection of dom/pos JAK2 (D4) into EBs 12 days before observing morphological characteristics of cardio-myocyte differentiation (beating) clearly resulted in almost all of the D4 EBs eventually containing significantly more beating areas than control EBs. These results suggested that overexpression of JAK2 could induce cardiomyocyte differentiation. We were not very successful in generating stable JAK2 dom/pos lines. Two clones were produced (Fig. 3E
); however, they did not survive past 10 days in culture, suggesting that JAK2 regulation of cardiomyogenesis was partly dependent on spatial and temporal cues.
We assessed from these data that JAK2 was a member of the heart differentiation pathway; however, we could not conclude that compensatory mechanisms for JAK2 exist, because we were never able to wipe out beating (differentiation) in ES cells that either contained JAK2 dom/neg constructs or AG490, unless concentrations of AG490 known to inhibit other kinases (or combination of kinases) were used. It is interesting to note that JAK2 has been knocked out, resulting in embryonic lethality, a phenotype the investigators of that work concluded was attributable to lack of red blood cells [26, 27]; however, a key result that we believe was underinterpreted in those JAK2/ embryos was the abnormality within the developing heart. Although the authors of the JAK2 knockouts diminished the function of JAK2 in heart development, based on our results, we believe JAK2 is indeed necessary for normal heart development.
The widely accepted, primary function for JAK2 is to phosphorylate STATs on specific tyrosine residues. This phosphorylation event results in STAT dimerization and translocation into the nucleus, where they act as transcription factors [17]. STAT function has been widely investigated, including their ablation by gene targeting. Of all of the STATs that have been knocked out [1017], the only STAT that resulted in embryonic lethality when removed was STAT3, which coincidentally resulted in lethality less than 1 day before the embryo would have presented beating cardiomyocytes. Consequently, based on our JAK2 results and the STAT3 knockouts, it was evident that we specifically investigate the role of STAT3 during cardiomyogenesis.
Our data showed that in beating areas, higher amounts of STAT3 were present compared with nonbeating areas. Moreover, the STAT3 encompassing these beating areas was in its active state as attested to by Western blot analysis and confocal microscopy using antibodies to the active form of STAT3. Functional analysis of STAT3 revealed a direct correlation between phosphorylation of STAT3 and beating, both of which were significantly decreased in a dose-dependent manner in AG490-treated EBs. However, because we were not able to wipe out beating or phosphorylation of STAT3 using AG490, it became obvious that STAT3 was only partially reliant on JAK2 and that other compensatory components are most likely involved in STAT3 regulation during EB differentiation. Alternatively, compensatory pathways such as the mitogen-activated protein kinase (MAPK) pathway also could be involved. To look at this possibility, we implemented experiments using the MAPK inhibitors OU126 and PD 98059; however, these drugs, when delivered at concentrations known to inhibit MAPK, gave inconclusive results. Specifically, UO126 did not inhibit EB differentiation, whereas PD 98059 wiped out the ability of an EB to beat. Cell death was not prevalent with this inhibitor, but overall EB growth was markedly slowed over a 2-week period compared with controls. More important, both MAPK inhibitors decreased overall beating in EBs that already had well-established beating areas (i.e., EBs that had been beating for at least 34 days). AG490, which has been reported to affect MAPK through JAK2, did not significantly decrease the number of beating areas in EBs that had well-established beating areas, strongly suggesting that MAPK may not be directly involved in cardiomyogenesis in ES cells. We are currently looking at other candidates that may act as compensatory mechanisms acting on STAT3.
A more intensive look at the role of STAT3 in cardiomyogenesis was accomplished by producing ES cell lines stably expressing a dom/neg form of STAT3. STAT3 has been shown to be uniquely regulated in some cell types by a naturally occurring STAT3 splice form known as STAT3ß [32, 33, 39]. STAT3ß lacks an internal 50-bp domain that is necessary for gene activation, and when under the control of a constitutively active promoter, STAT3ß acts to prevent the normal action of STAT3 [32]. We produced 10 clones that expressed STAT3ß at various levels. Interestingly, at low levels of expression, beating areas within EBs were significantly reduced even when compared with JAK2 dom/neg mutant ES cell lines. Few beating areas were found in EBs containing levels of STAT3ß higher than the low-level expressers. All of the low, medium, and high STAT3ß-expressing ES cell lines grew well for at least 1 month, providing evidence that inhibition of the beating phenotype was not simply due to overall cell death.
A very interesting finding of this work was the downregulation of specific cardiac genes in STAT3-inhibited ES cells. When expression of these genes was analyzed in STAT3ß-expressing EBs, Nkx2.5, the
1 subunit of the L-type Ca2+ channel (DHP), and cardiac actin were not expressed. Examination of the Nkx2.5 promoter and cardiac-specific enhancer showed STAT3 binding sites in both areas [40]. This represents a potential mechanism for STAT3 regulation of Nkx2.5, and lack of Nkx2.5 could prevent complete cardiomyocyte differentiation via downstream effects.
Two genes that may be regulated by Nkx2.5 include the
1 subunit of the DHP receptor and cardiac actin. According to promoter studies conducted by Liu et al. [41], the area of the
1 subunit of DHP promoter that is vital to expression contains two Nkx2.5 binding sites. Removal of these areas results in a significant loss of expression. In addition, Nkx2.5 has been shown to bind to serum-response elements within the cardiac actin gene, which are necessary for cardiac-specific promoter activity [42]. Thus, the regulation of Nkx2.5 by STAT3 provides a pathway in which Stat3 inhibition could result in the loss of a beating phenotype and incomplete differentiation of cardiomyocytes.
However, Nkx2.5 knockout mice form a defective, but beating, heart tube [43]. This suggests that STAT3 may affect the
1 subunit of the DHP receptor and cardiac actin through another mechanism. One possibility is that STAT3 binds the 5' untranslated region of the cardiac actin gene directly via its STAT binding element [44]. We were not able to find evidence supporting a direct interaction between STAT3 and the
1 subunit of the DHP receptor, but upon closer inspection of the promoter studies by Liu et al. [41], we noticed a C/EBPß binding site in the area critical for gene expression. C/EBPs have been shown to be reliant on STAT3 for expression [34, 35]. Furthermore, a study by Niehof et al. [35] showed that IL-6induced tethering of STAT3 to the C/EBPß promoter is vital for gene expression. Consequently, cardiac gene expression can be lost by direct inhibition of STAT3 DNA binding on cardiac gene promoters as well as by loss of expression of other STAT3-depen-dendent cardiac gene transcription factors such as the C/EBPs.
Several investigations have put forth evidence demonstrating that STAT3 signaling is important for early development [31, 45, 46]. However, many of those STAT3 studies were not able to directly analyze STAT3 function during cardiomyogenesis, primarily because of the limitation of the model systems that were used. For example, although Zhong et al. [31] elegantly revealed the first evidence that STAT3 was localized to areas within the embryo, including the presumptive heart field, and was active when cardiomyocyte formation would be occurring (i.e., E7.5E8.5), analysis of STAT3 function during cardiomyogenesis was not determined. In mammalian development it is extremely difficult to procure precardiomyocyte mesoderm to look at specified signal transduction mechanisms. The difficulty in analyzing STAT3 in heart development was additionally exemplified in the STAT3 knockouts. Although buttressing evidence for the importance of STAT3 during early embryogenesis, the STAT3 knockout failed to provide a functional role for STAT3 during cardiomyogenesis because its ablation resulted in embryonic lethality at the time of cardiomyocyte formation (i.e., E7.0E7.5) [45]. Consequently, it is unquestionable that the ES cell model system aptly served as a powerful tool for determining the role of the JAK/STAT pathway in the initial differentiation pathway of cardiomyocytes.
However, it is important to note that a second, and undoubtedly equally important aspect to analyzing the ES cell model system has been to determine their applicability for therapeutic use, as suggested by others [4749]. Although many investigations have touted the importance of ES cells for future cures for diseases, such as Parkinsons, pancreatic, and cardiovascular disease, few have capitalized on understanding, as completely as possible, the molecular and proteomic mechanisms that control ES cell differentiation. Understanding these mechanisms is a key step that will inevitably be required before ES cell therapies can be consistently relied on to manage or cure such diseases. Without such knowledge, ES cell therapies will be basically "flying blind," creating undue risks such as aberrant teratoma formation from the ES cells being used to cure the disease. Consequently, in this investigation, we provide data describing important steps and mechanisms that regulate how ES cells differentiate down the cardiomyocyte pathway; data that may be important for more accurately manipulating ES cells and assessing their differentiation potentials increase confidence that ES cells can be eventually used for alleviating cardiovascular problems.
In summary, we propose that STAT3 is a cornerstone in the cardiomyogenesis pathway and that JAK2 works through STAT3 to promote cardiomyogenesis. We are currently investigating other mechanisms that could be assisting JAK2 activation of STAT3.
 |
ACKNOWLEDGMENTS
|
|---|
K.F. and G.R. contributed equally to this study. We would like to thank Dr. Robert Lechleider, Dr. Chris Taylor, and Tammy Gallicano for their critical reading of the manuscript. We also thank Alex C. Potocki for his confocal microscopy guidance. Work in this investigation was supported by the Transgenic Shared Resource under the directorship of G.I.G., who is supported by Cancer Center Support Grant CA51008-13. This work was primarily supported by grant HL70204-01 from the NIH and grant O265429U from the American Heart Association, both awarded to G.I.G.
 |
REFERENCES
|
|---|
- Arai A, Yamamoto K, Toyama J. Murine cardiac progenitor cells require visceral embryonic endoderm and primitive streak for terminal differentiation. Dev Dyn 1997;210:344353.[CrossRef][Medline]
- Ji RP, Phoon CKL, Aristizabal O et al. Onset of cardiac function during early mouse embryogenesis coincides with entry of primitive erythroblasts into the embryo proper. Circ Res 2003;92:133135.[Abstract/Free Full Text]
- Wobus AM, Wallukat G, Hescheler J et al. Pluripotent mouse embryonic stem cells are able to differentiate into cardiomyocytes expressing chronotropic responses to adrenergic and cholinergic agents and Ca2+ channel blockers. Differentiation 1991;48:173182.[CrossRef][Medline]
- Metzger JM, Lin WI, Samuelson LC. Vital staining of cardiac myocytes during embryonic stem cell cardiogenesis in vitro. Circ Res 1996;78:547552.[Abstract/Free Full Text]
- Hescheler J, Fleischmann BK, Lentini S et al. Embryonic stem cells: a model to study structural and functional properties in cardiomyogenesis. Cardiovasc Res 1997;36:149162.[Free Full Text]
- Xu C, Liguori G, Adamson E et al. Specific arrest of cardiogenesis in cultured embryonic stem cells lacking cripto-1. Dev Biol 1998;196:237241.[CrossRef][Medline]
- Meyer N, Jaconi M, Landopoulou A et al. A fluorescent reporter gene as a marker for ventricular specification in ES-derived cardiac cells. FEBS Lett 2000;478:151158.[CrossRef][Medline]
- Zhou X, Quann E, Gallicano GI. Differentiation of nonbeating embryonic stem cells into beating cardiomyocytes is dependent on downregulation of PKCß and
in concert with upregulation of PKC
. Dev Biol 2003;255:407422.[CrossRef][Medline]
- Maltsev VA, Wobus AM, Rohwedel J et al. Cardiomyocytes differentiated in vitro from embryonic stem cells developmentally express cardiac-specific genes and ionic currents. Circ Res 1994;75:233244.[Abstract/Free Full Text]
- Durbin JE, Hackenmiller R, Simon MC et al. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 1996;84:443450.[CrossRef][Medline]
- Kaplan MH, Schindler U, Smiley ST et al. Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 1996;4:313319.[CrossRef][Medline]
- Kaplan MH, Sun YL, Hoey T et al. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 1996;382:174177.[CrossRef][Medline]
- Meraz MA, White JM, Sheehan KC et al. Targeted disruption of the mouse Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signalling pathway. Cell 1996;84:431442.[CrossRef][Medline]
- Thierfelder WE, van Deursen JM, Yamamoto K et al. Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 1996;382:171174.[CrossRef][Medline]
- Liu X, Robinson GW, Wagner KU et al. Stat5 is mandatory for adult mammary glad development and lactogenesis. Genes Dev 1997;11:179186.[Abstract/Free Full Text]
- Udy GB, Towers RP, Snell RG et al. Requirement of Stat5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci U S A 1997;94:72397244.[Abstract/Free Full Text]
- Imada K, Leonard WJ. The Jak-STAT pathway. Mol Immunol 2000;37:111.[CrossRef][Medline]
- Kunisada K, Tone E, Fujio Y et al. Activation of gp130 transduces hypertrophic signals via STAT3 in cardiac myocytes. Circulation 1998;98:346352.[Abstract/Free Full Text]
- Booz GW, Day JNE, Baker KM. Interplay between the cardiac renin angiotensin system and JAK-STAT signaling: role in cardiac hy pertrophy, ischemia/reperfusion dysfunction, and heart failure. J Mol Cell Cardiol 2002;34:14431453.[CrossRef][Medline]
- Jacoby JJ, Kalinowski A, Liu M et al. Cardiomyocyte-restricted knockout of STAT3 results in higher sensitivity to inflammation, cardiac fibrosis, and heart failure with advanced age. Proc Natl Acad Sci U S A 2003;100:1292912934.[Abstract/Free Full Text]
- Hattori R, Maulik N, Otani H et al. Role of STAT3 in ischemic preconditioning. J Mol Cell Cardiol 2001;33:19291936.[CrossRef][Medline]
- Negoro S, Kunisada K, Tone E et al. Activation of JAK/STAT pathway transduces cytoprotective signal in rat acute myocardial infarction. Cardiovasc Res 2000;47:797805.[Abstract/Free Full Text]
- Xuan YT, Guo Y, Han H et al. An essential role of the JAK-STAT pathway in ischemic preconditioning. Proc Natl Acad Sci U S A 2001;98:90509055.[Abstract/Free Full Text]
- Mascareno E, El-Shafei M, Maulik N et al. JAK/STAT signaling is associated with cardiac dysfunction during ischemia and reperfusion. Circulation 2001;104:325329.[Abstract/Free Full Text]
- Bolli R, Dawn B, Xuan Y.-T. Role of the JAK-STAT pathway in protection against myocardial ischemia/reperfusion injury. Trends Cardiovasc Med 2003;13:7279.[CrossRef][Medline]
- Neubauer H, Cumano A, Muller M et al. Jak2 deficiency defines an essential developmental checkpoint in definitive hematopoiesis. Cell 1998;93:397409.[CrossRef][Medline]
- Parganas E, Wang D, Stravopodis D et al. Jak2 is essential for signaling through a variety of cytokine receptors. Cell 1998;93:385395.[CrossRef][Medline]
- Kotenko SV, Izotova LS, Pollack BP et al. Other kinases can substitute for Jak2 in signal transduction by interferon-gamma. J Biol Chem 1996;271:1717417182.[Abstract/Free Full Text]
- Caldenhoven E, van Dijk TB, Solari R et al. STAT3beta, a splice variant of transcription factor STAT3, is a dominant negative regulator of transcription. J Biol Chem 1996;271:1322113227.[Abstract/Free Full Text]
- Feng J, Witthuhn BA, Matsuda T et al. Activation of Jak2 catalytic activity requires phosphorylation of Y1007 in the kinase activation loop. Mol Cell Biol 1997;17:24972501.[Abstract]
- Zhong H, Murphy TJ, Minneman KP. Activation of signal transducers and activators of transcription by alpha(1A)-adrenergic receptor stimulation in PC12 cells. Mol Pharmacol 2000;57:961967.[Abstract/Free Full Text]
- Duncan SA, Zhong Z, Wen Z et al. STAT signaling is active during early mammalian development. Dev Dyn 1997;280:190198.
- Catlett-Falcone R, Landowski TH, Oshiro MM et al. Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity 1999;10:105115.[CrossRef][Medline]
- Cantwell CA, Sterneck E, Johnson PF. Interleukin-6-specific activation of the C/EBPdelta gene in hepatocytes is mediated by Stat3 and Sp1. Mol Cell Biol 1998;18:21082117.[Abstract/Free Full Text]
- Niehof M, Streetz K, Rakemann T et al. Interleukin-6-induced tethering of STAT3 to the LAP/C/EBPß promoter suggests a new mechanism of transcriptional regulation by STAT3. J Biol Chem 2001;276:90169027.[Abstract/Free Full Text]
- Ernst M, Oates A, Dunn AR. gp130-mediated signal transduction in embryonic stem cells involves activation of Jak and Ras/mitogen-activated protein kinase pathways. J Biol Chem 1996;271:3013630143.[Abstract/Free Full Text]
- Niwa H, Burdon T, Chambers I et al. Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 1998;12:20482060.[Abstract/Free Full Text]
- Raz R, Lee C-K, Cannizzaro LA et al. Essential role of STAT3 for embryonic stem cell pluripotency. Proc Natl Acad Sci U S A 1999;96:28462851.[Abstract/Free Full Text]
- Zhang Y, Turkson J, Carter-Su C et al. Activation of Stat3 in v-Src-transformed fibroblasts requires cooperation of Jak1 kinase activity. J Biol Chem 2000;275:2493524944.[Abstract/Free Full Text]
- Reecy JM, Li X, Yamada M et al. Identification of upstream regulatory regions in the heart-expressed homeobox gene Nkx2-5. Development 1999;126:839849.[Abstract]
- Liu L, Fan I, El-Zaru MR et al. Regulation of DHP receptor expression by elements in the 5'-flanking sequence. Am J Physiol Heart Circ Physiol 2000;278:H1153H1162.[Abstract/Free Full Text]
- Chen CY, Schwartz RJ. Recruitment of the tinman homolog Nkx-2.5 by serum response factor activates cardiac alpha-actin gene transcription. Mol Cell Biol 1996;16:63726384.[Abstract]
- Lyons I, Pasons LM, Hartley L et al. Myogenic and morphogenetic defects in the heart tubes of murine embryos lacking the homeo box gene Nkx2-5. Genes Dev 1995;9:16541666.[Abstract/Free Full Text]
- Kunisada K, Negoro S, Tone E et al. Signal transducer and activator of transcription 3 in the heart transduces not only a hypertrophic signal but a protective signal against doxorubicin-induced cardiomyopathy. Proc Natl Acad Sci U S A 2000;97:315319.[Abstract/Free Full Text]
- Takeda K, Noguchi K, Shi W et al. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci U S A 1997;94:38013804.[Abstract/Free Full Text]
- Valdembri D, Serini G, Vacca A et al. In vivo activation of JAK2/ STAT-3 pathway during angiogenesis induced by GM-CSF. FASEB J 2002;16:225227.[Free Full Text]
- Lumelsky N, Blondel O, Laeng P et al. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 2001;292:13891394.[Abstract/Free Full Text]
- Mazurova Y. New therapeutic approaches for the treatment of Huntingtons disease. Acta Medica 2001;44:119123.
- Vogel G. Stem cell research: rat brains respond to embryonic stem cells. Science 2002;295:254255.
- Quitschke WW, DePonti-Zilli L, Lin ZY et al. Identification of two nuclear factor-binding domains on the chicken cardiac actin promoter: implications for regulation of the gene. Mol Cell Biol 1989;9:32183230.[Abstract/Free Full Text]
- Wang Q, Sigmund CD, Lin JJ-C. Identification of cis elements in the cardiac troponin T gene conferring specific expression in cardiac muscle of transgenic mice. Circ Res 2000;86:478484.[Abstract/Free Full Text]
- Parmacek MS, Vora AJ, Shen T et al. Identification and characterization of a cardiac-specific transcriptional regulatory element in the slow/cardiac troponin gene. Mol Cell Biol 1992;12:19671976.[Abstract/Free Full Text]
- Meydan N, Grunberger T, Dadi H et al. Inhibition of acute lymphoblastic leukaemia by a Jak-2 inhibitor. Nature 1996;379:645648.[CrossRef][Medline]
Received October 21, 2004;
accepted for publication December 23, 2004.
This article has been cited by other articles:

|
 |

|
 |
 
D. Thomas, S. Friedman, and R.-Y. Lin
Thyroid stem cells: lessons from normal development and thyroid cancer
Endocr. Relat. Cancer,
March 1, 2008;
15(1):
51 - 58.
[Abstract]
[Full Text]
[PDF]
|
 |
|