Stem Cells http://www.peprotech.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Stem Cells Vol. 24 No. 9 September 2006, pp. 2098 -2109
doi:10.1634/stemcells.2006-0009; www.StemCells.com
© 2006 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Files
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fougère-Deschatrette, C.
Right arrow Articles by Weiss, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fougère-Deschatrette, C.
Right arrow Articles by Weiss, M. C.

TISSUE-SPECIFIC STEM CELLS

Plasticity of Hepatic Cell Differentiation: Bipotential Adult Mouse Liver Clonal Cell Lines Competent to Differentiate In Vitro and In Vivo

Catherine Fougère-Deschatrettea, Tereza Imaizumi-Scherrera, Hélène Strick-Marchanda, Serban Morosanb, Pierre Charneauc, Dina Kremsdorfb, Daniela M. Fausta, Mary C. Weissa

aUnité de Génétique de la Différenciation, Unité de Recherche Associée 2578 du Centre National de la Recherche Scientifique and
cLaboratoire de Virologie Moléculaire et Vectorologie, Institut Pasteur, Paris, France;
bUnité 370 de l’Institut National de la Santé et de la Recherche Médicale/Institut Pasteur, Centre Hospitalier Universitaire Necker, Paris, France

Key Words. Primary hepatocyte cultures • Hepatic stem cells • Liver regeneration model • Karyotype • Bile duct/oval cell markers • Epithelial polarity • Matrigel • A6

Correspondence: Mary C. Weiss, Ph.D., Génétique de la Différenciation, Institut Pasteur, 25 Rue du Docteur Roux, 75724 Paris Cedex 15, France. Telephone: (33) 1-4568-8500; Fax: (33) 1-4061-3231; e-mail: mweiss{at}pasteur.fr

Received January 5, 2006; accepted for publication May 16, 2006.

    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
In fetal liver, bipotential hepatoblasts differentiate into hepatocytes and bile duct cells (cholangiocytes). The persistence of such progenitor cells in adult mouse liver is still debated. In damaged liver of adult murine animals, when hepatocyte proliferation is compromised, bipotential oval cells emerge, probably from bile ducts, proliferate, and differentiate to regenerate the liver. However, treatment to elicit oval cell proliferation is not necessary to obtain bipotential stem cells from adult mouse liver. Here, we have isolated bipotential clonal cell lines from healthy liver of 8–10-week-old C57BL/6 mice. Primary cultures established from hepatocyte-enriched suspensions were characterized by time-lapse image acquisition, immunocytology, and RNA transcript analysis. Although hepatocytes dedifferentiated with loss of apical polarity and other hepatocyte markers, they rapidly activated expression of bile duct/oval cell markers. Reversibility of these processes was achieved in part by culture under dilute Matrigel or by aging of confluent cultures. Cell lines were obtained at high frequency from mass cultures, from isolated colonies, and by primary cloning of the hepatocyte-enriched suspension. Cells of the clonal cell lines do not grow in soft agar and are nontumorigenic, and they express cytokeratin 19, A6 antigen, and {alpha}6 integrin, as well as a large panel of hepatocyte functions. Furthermore, they can participate in liver regeneration in albumin-urokinase-type plasminogen activator/severe combined immune-deficient mice, where they differentiate in clusters of hepatocytes and occasionally bile ducts. These results demonstrate the existence, in normal adult mouse liver, of a significant pool of clonogenic cells that are (or can become) bipotential.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
Hepatocytes are highly differentiated epithelial cells expressing a large array of genes and presenting a unique form of cell polarity [1]. Although hepatocytes derive from diploid hepatoblast progenitors, they often become binuclear and/or polyploid, only a minority remaining diploid in adult rat liver [2]. After partial hepatectomy, a majority of hepatocytes are able to re-enter the cell cycle rapidly, including both the mono- and binuclear populations [2]. The astounding proliferation potential of hepatocytes in vivo has been documented by serial repopulation experiments [3]. Under certain pathological conditions, when hepatocytes can no longer divide, oval cells emerge from the periportal regions, probably deriving from cholangiocytes [47]. The heterogeneous oval cell compartment contains cells that possess an expression pattern similar to hepatoblasts and cholangiocytes [8]. These cells divide, migrate into the parenchyma, and differentiate, finally regenerating the damaged liver.

Many laboratories have attempted to harness the proliferation potential of hepatocytes to obtain their expansion in culture, with specially elaborated media and culture conditions [911] to study metabolic processes, including metabolism of xenobiotics [12], and to develop bioartificial liver devices [13] and in vitro models for infection by hepatotropic viruses and parasites [14, 15]. The attempts have been at least partially thwarted by the fact that proliferation and differentiation of hepatocytes in culture appear to be mutually exclusive [9, 11]. In some cases, transgenes that encourage the growth of differentiated hepatocytes have made it possible to isolate well-differentiated lines [1619]. Normal adult rat liver was used to derive the extensively analyzed WB-F344 cells, which express both hepatocyte and bile duct/oval cell markers [20] but which gave rise only to hepatocytes upon transplantation [21].

To extend our earlier experiments on bipotential stem cell lines from mouse embryonic liver [8], we attempted to obtain, from liver of adult mice, cell lines that can proliferate indefinitely to test their differentiation potential. Hepatocyte primary cultures were prepared from adult C57BL/6 mice and cultivated in a medium that readily permitted the indefinite growth of cells that remained nontransformed. In these continuously dividing cultures, cells expressed bile duct/oval cells, as well as fetal and new born hepatocyte markers, whereas in aged confluent cultures, adult hepatocyte markers were also detected. Similar properties were demonstrated using established cultures derived by primary cloning from single cells. Furthermore, cells of the clonal lines, when tested in the albumin-urokinase-type plasminogen activator (uPA)/severe combined immune-deficient (Alb-uPA/SCID) mouse model of liver regeneration, were capable of differentiating as hepatocytes or as bile ducts. Therefore, these clonal lines are bipotential. Consequently, we conclude that normal adult mouse liver must contain a significant pool of clonogenic cells that are, or can become, bipotential.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
Primary Hepatocyte Suspensions
Animal procedures were in accordance with institutional guidelines. The major liver lobe was removed from sacrificed 8–10-week-old C57BL/6 female mice (Charles River, L’Arbresle, France, http://www.criver.com) and perfused [22] (6 ml/minutes, 37°C) with 30 ml of buffer (137 mM NaCl, 2.7 mM KCl, 0.28 mM Na2HPO4, 10 mM Hepes, pH 7.65) followed by the same solution containing 5 mM CaCl2 and 25 µg/ml Liberase Blendzyme 3 (Roche, Indianapolis, IN, http://www.roche-applied-science.com). Dissociated cells were released in Williams’ E medium (Invitrogen, Carlsbad, CA, http://www.invitrogen.com), 10% fetal calf serum (FCS) (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) and 3.5 mg/ml D-glucose, filtered through a 40-µm strainer (BD Biosciences, San Jose, http://www.bdbiosciences.com), centrifuged (30 seconds at 120g), resuspended in 5 ml of medium, and overlaid on a 5-ml 60% Percoll (Amersham Biosciences Europe, Saclay, France, http://www.amershambiosciences.com) iso-osmotic cushion to eliminate the majority of dead cells and nonparenchymal cells. After centrifugation (2 minutes at 720g), the pellet, highly enriched in hepatocytes [23], was gently disrupted and cells were counted (yield, 2–10 x 106 cells).

Cell Culture Conditions
Cells were cultured at 37°C in a humidified incubator with 5% CO2, in dishes (Falcon; BD Biosciences) coated with rat tail type I collagen (BD Biosciences), in Williams’ E medium, 10% FCS, 0.1 µM dexamethasone (Dex; Sigma-Aldrich) (Decadron; Merck & Co., Inc., Whitehouse Station, NJ, http://www.merck.com), 1x insulin-transferrin-selenium (ITS-G) (Invitrogen), 50 ng/ml epidermal growth factor (EGF) (Peprotech, Rocky Hill, NJ, http://www.peprotech.com), 10 mM nicotinamide, penicillin, streptomycin (Sigma-Aldrich), fungizone (Apothecon, Princeton, NJ, http://www.apothecon.nl), and, where indicated, 50 nM glucagon (Sigma-Aldrich). Incubation with 0.1 mM 8-4-chlorophenylthio-cAMP (CPT-cAMP) (Sigma-Aldrich) was for 48 hours. Cells were transferred with trypsin-EDTA. Colcemid-arrested, Giemsa-stained metaphases were used for standard karyotypes. For culture in sandwich configuration [24], cells were seeded at 2.5 x 104 cells per cm2 on collagen-coated glass coverslips, overlaid with 250 µg/ml Matrigel (BD Biosciences) the following day, and incubated for 2 days (primary cultures) or 2–8 days (clonal cultures). The fluorescein diacetate (FDA; Sigma-Aldrich) functional polarity assay was performed according to [25]. Time-lapse photomicroscopy of primary cultures inoculated at 8 x 103 cells per cm2 was performed with a Zeiss Axiovert 200M microscope equipped with a thermoregulated chamber and a CoolSNAP HQ camera (Roper Scientific, Tucson, AZ, http://www.roperscientific.com), using a x10 phase contrast objective and Simple PCI software (Compix Inc. Imaging Systems, Cranberry Township, PA, http://www.cimaging.net) for image acquisition from four different fields of approximately 100 cells, every 10 minutes, for up to 73 hours.

Transduction of Clonal Cell Lines
The TRIP{Delta}U3.mPGK-GFP vector plasmid was constructed from pTRIP{Delta}U3.EF1{alpha}GFP [26] by promoter replacement. The mouse phosphoglycerol kinase (PGK) promoter was copied by polymerase chain reaction (PCR) from 3T3 cells, using primers (sequences available from authors) flanked by restriction sites, and inserted after deletion of the EF1{alpha} promoter by digestion with the appropriate enzymes. Cells were transduced with 150 ng/ml TRIP{Delta}U3.mPGK-GFP vector particles and 5 µg/ml DEAE-dextran in culture medium [27] and expanded, and the fraction of green fluorescent protein (GFP)-positive cells was determined by fluorescence activated cell sorter (BD Biosciences) analysis: clone 3-GFP 66%, clone 4-GFP 52.5%, clone 8-GFP 60.5%.

Soft Agar and Tumor Formation Assays
Soft agar assays were performed [28], using BW1J hepatoma cells as positive control. Progeny from expanded colonies at 90 generations and the clones at 120 generations all failed to grow. Tumorigenicity assays in nude mice (Janvier, Le Genest-St-Isle, France, http://www.janvier-breedingcenter.com) with up to 5 x 106 cells from each clone, before and after lentiviral transduction, were all negative after 4 months.

Injection and Analysis of Cells of Clonal Lines in Alb-uPA/SCID Mice
Alb-uPA/SCID mice were obtained [29], injected intrasplenically with 0.5 x 106 cells of GFP-transduced clones (five mice with clone 3-GFP, three with clone 4-GFP, and seven with clone 8-GFP), and treated to reduce macrophage proliferation [30]. Serial cryostat sections were prepared from livers 3, 4, and 6 weeks after injection, fixed, and processed for immunohistochemistry, using antibodies (Abs) and reagents as described [29].

Immunocytochemistry and Immunofluorescence
Cells on collagen-coated glass coverslips (8 x 103 cells per cm2) were fixed, after 2–3 days of culture, with 3% formaldehyde (20 minutes at room temperature) or with –20°C methanol (10 minutes on ice). Incubation with primary Abs was performed overnight at 4°C in phosphate-buffered salt solution with 10 mg/ml bovine serum albumin and 10% decomplemented goat serum. Abs used were those given in reference 29, plus rat monoclonal against {alpha}6 integrin (anti-CD 49f; BD Biosciences) or A6 (a gift from N. Engelhardt, Cancer Research Center, Moscow), mouse monoclonal anti-connexin 32 (Cx32; Zymed Laboratories, San Francisco, http://www.zymed.com), and our rabbit polyclonal anti-mouse albumin. Abs against A6 or {alpha}6 integrin were tested on liver sections from 9-week-old C57BL/6 male mice (Janvier), some fed for 3 weeks with a choline-deficient ethionine diet (CDE; [4], using food from MP-ICN (Irvine, CA) and ethionine from Sigma-Aldrich. Incubations with secondary Abs were for 1–2 hours at room temperature: goat-anti-rabbit-cyanine3, goat-anti-mouse-fluorescein isothiocyanate (FITC), goat-anti-rat-FITC and goat-anti-rat-horseradish peroxidase (HRPO) (Caltag, Burlingame, CA, http://www.caltag.com). HRPO was revealed with diaminobenzidine (DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.com). Cells for immunocytochemistry were counterstained with Mayer’s Hematoxylin (DakoCytomation). To stain filamentous actin (F-actin), cells were incubated with phalloidin-FITC (Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com) for 1–2 hours at room temperature. Coverslips were mounted with Immunomount (Thermo Shandon Inc., Pittsburgh, http://www.thermo.com) and photographed with a Zeiss Axioplan two photomicroscope (Carl Zeiss, Jena, Germany, http://www.zeiss.com).

RT-PCR Assays
Reverse transcription (RT)-PCR was performed as described [8] with primers for the following: {alpha}-fetoprotein (AFP), Alb, alcohol dehydrogenase (ADH), aldolase B (AldB), apolipoprotein AIV, phenylalanine hydroxylase, phosphoenolpyruvate carboxykinase, and tyrosine aminotransferase (TAT) (references for primers are given in [8]), mouse 28 S rRNA (28S) [31], {alpha}1 antitrypsin ({alpha}1AT) (TGCCACTGCTGTCTTCCTTC and GTCAGCACAGCCTTATGCAC), cytokeratin 19 (CK19) (ATTACAACCACTACTTTAAGACCATCGAGG and TTTCATGCTGAGCTGGGACTGC), glucose-6-phosphatase (CGCCTTCTATGTCCTCTTTCCC and GTTTCAGCCACAGCAATGCC), glutamine synthetase (GS) (TGTACCTCCATCCTGTTGCC and TAACCTCCGCATTTGTCCCC), ornithine transcarbamylase (OTC) (GCTAAAGAAGCATCCATCCC and TCTCCTTGGCATACTGCTC), and tryptophane oxidase (TO) (TGTCTCCAGCATCAGGCTTC and TCTGCTCCTGCTCCGATTTC).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
Evolution of Cell Morphology, Growth, and Mitoses in Hepatocyte Primary Cultures
Cell suspensions enriched in hepatocytes were obtained by perfusion of liver from normal adult C57BL/6 female mice and inoculated onto collagen-coated dishes in Williams’ E medium supplemented with FCS, ITS-G, Dex, nicotinamide, and EGF (complete medium, as described under Materials and Methods). Three hours after inoculation, hepatocytes were well attached, isolated or in clusters, with round nuclei and dense cytoplasm, many of them binuclear as expected (Fig. 1A). Often they contained vacuoles that appeared to be internalized bile canaliculi (data from the FDA assay not shown, see below). At 24 hours, the cells had spread, giving rise to a confluent culture, and after 2 days, the whole culture had undergone reorganization, with the nuclei still round. By 4 days, cells were no longer identifiable as hepatocytes, except that some remained binuclear. All of these reproducible changes are further illustrated in the time-lapse videos (supplemental online Videos 1, 2). At 5 days, nests of transparent cells were detected, which by 9 days had enlarged and were clearly epithelial. A tightly packed confluent monolayer had formed by 3 weeks of culture.


Figure 1
View larger version (107K):
[in this window]
[in a new window]
 
Figure 1. Morphology, proliferation and karyotypic analysis of hepatocyte primary cultures from adult mouse. (A): Photomicrographs of primary cultures (3 hours to 22 days) inoculated at 2 x 104 cells per cm2 in complete medium. The first wave of mitoses occurred at 3–4 days, as illustrated in supplemental online Videos 1 and 2. By 9 days, nests of transparent cells were actively dividing (inset, mitoses). Optical magnification, x50. (B): Primary cultures inoculated at 2.5 x 104 to 2.5 x 102 cells per cm2 in 6-cm diameter dishes. Cells were fixed after 3 weeks and stained with methylene blue. (C): Cell proliferation in hepatocyte primary cultures with different media. Cells were inoculated in 6-cm diameter dishes with complete medium or with media lacking the indicated component(s). Cells were counted on day 10; total yields were replated at subconfluent densities and counted again on day 21 after the first inoculation. (D): Karyotype distribution in hepatocyte primary cultures inoculated at 1 x 104 cells per cm2. In experiment 1, the chromosome numbers were determined at days 4, 8, and 11. Cultures were passaged at day 9. In experiment 2, performed under identical conditions with an independent culture, karyotypes were examined at day 17 (3 days after the first passage) and at day 41, after five passages. For each chromosome preparation, 50 metaphase spreads were counted. Abbreviations: EGF, epidermal growth factor; d, day(s); h, hours.

 
The influence of inoculation density on cell proliferation is illustrated in Figure 1B. Inoculated in a 6-cm-diameter dish, 5 x 105 cells gave rise in 21 days to a very dense culture that could be subcultured for months. Decreasing the inoculation density to 1 x 105 cells resulted in a patchy culture. At lower densities, most of the cells progressively degenerated or stayed quiescent for weeks, although a few succeeded in giving rise to dense epithelial colonies, at a frequency of approximately 0.05% for 104 inoculated cells.

Many laboratories have described additives to the culture medium that improve the quality of hepatocyte primary cultures [24, 3234]. After testing the effects of a variety of these additives, we defined a new combination of supplements for Williams’ E medium (complete medium). Figure 1C shows the importance for proliferation of each supplement. Without serum or Dex, cells changed to a fibroblast-like morphology, whereas in the absence of EGF, they retained their hepatocyte morphology. Cell degeneration was observed in cultures without nicotinamide from day 3 and at approximately days 6–7 without Dex or EGF. Cultures could be established without ITS-G, with only 1% FCS, or with only 5 ng/ml EGF, but morphological appearance and proliferation were suboptimal.

On the 4th day, in primary cultures inoculated with 2 x 105 cells, 88% of the metaphases were tetraploid (Fig. 1D). This result was not unexpected, since binuclear hepatocytes were predominant in the initial population and are known to give rise at mitosis to tetraploid metaphases [2]. Such metaphases, observed throughout several weeks of culture, could also arise during mitoses of tetraploid mononuclear hepatocytes and of binuclear cells generated in culture by failure of cytokinesis [2, 35] (supplemental online Videos 1 and 2). With time, the number of diploid metaphases increased progressively (Fig. 1D). The concomitant predominance of diploid metaphases and of the proliferating transparent epithelial cells in two independent experiments implies that these cells contribute to the diploid metaphases.

Expression of Hepatocyte Markers in Primary Cultures
It is known that culturing of hepatocytes results in a modification of gene expression frequently referred to as dedifferentiation, and much effort has been devoted to minimize these effects [9, 36, 37]. We documented these changes in mass cultures by RT-PCR (Fig. 2A) and at the cellular level by analysis of markers associated with the apical domain of the hepatocyte, the tiny area of the plasma membrane that defines bile canaliculi (Fig. 2B). This polarity is generally lost, except when cells are cultivated in a sandwich configuration [9, 38]. Three patterns of gene expression can be observed in Figure 2A: constancy (albumin), activation (AFP and CK19), and loss of expression (TAT). As previously shown [39], AFP was re-expressed by 24 hours after plating. CK19, a bile duct/oval cell marker [40], already weakly induced at this time, has been described in hepatocyte primary cultures [36] or in vivo under pathological conditions [41, 42]. By 3 days of culture, hepatocyte polarity was disorganized (Fig. 2B). First, the FDA functional assay revealed that most bile canaliculi were distended [43]. Second, F-actin was not concentrated at the cell membrane as in polarized hepatocytes but distributed as stress fibers in the cytoplasm [44]. Finally, the apical localization of dipeptidylpeptidase IV (DPPIV) [45] was disturbed.


Figure 2
View larger version (99K):
[in this window]
[in a new window]
 
Figure 2. Dedifferentiation in hepatocyte primary cultures and its reversibility. (A): Reverse transcription-polymerase chain reaction (RT-PCR) analysis of RNA prepared from primary hepatocyte cultures. Cells were inoculated at 2.5 x 104 cells per cm2 in complete medium, and RNA was extracted at different times up to 11 days. For day 0, RNA was directly prepared from the hepatocyte-enriched suspension. Lane – shows PCRs without template. (B): Phase contrast and fluorescence photomicrographs from three apical polarity assays on day 3 primary hepatocyte cultures. To test functional polarity, cells were incubated with nonfluorescent fluorescein diacetate (FDA), which is cleaved by cytoplasmic esterases and the resulting fluorescein is exported into bile canaliculi when hepatocytes are polarized. Structural polarity was tested on cells fixed and stained with either phalloidin-fluorescein isothiocyanate to reveal F-actin or with anti-dipeptidylpeptidase IV (anti-DPPIV). (C): RT-PCR analysis for hepatocyte functions 7 weeks after inoculation of a primary hepatocyte culture. Cells were transferred three times during the 5 weeks following inoculation and then inoculated at 104 cells per cm2 and left at confluence until RNA preparation 2 weeks later. Some of the hepatocyte markers were continuously expressed, and others were extinguished and re-expressed (see below Fig. 5). Specific products for 28S rRNA (+) were undetectable in the absence of reverse transcriptase (–). (D): Phase contrast and fluorescence photomicrographs of primary hepatocyte cultures overlaid with dilute Matrigel and assayed for apical polarity as in (B). Optical magnifications for (B) and (D), x50 for FDA, x100 for F-actin, and x158 for DPPIV.

 
Two strategies were employed to test reversibility of this dedifferentiation. Numerous publications attest to the importance of close cell contacts for hepatocyte differentiation [37, 46]. First, cultures were left at confluence for many days in complete medium, where no signs of overgrowth or cell death were observed, and transcript analysis was performed. Under these conditions, all the hepatic functions tested were expressed or re-expressed (Fig. 2C). Second, 24-hour primary cultures were overlaid with dilute Matrigel and hepatocyte polarity tested, as described above, 2 days later (Fig. 2D). The bile canaliculi, visible in the phase contrast image as white spaces running between cells, were filled with fluorescein, indicating integrity of the apical pole and a functional draining system. F-actin and DPPIV were both properly localized to the apical domain. Altogether, these results demonstrate that dedifferentiation is reversible, even after a number of passages.

To determine whether hepatocyte dedifferentiation associated with culture encompassed activation of expression of bile duct/oval cell markers other than CK19, we turned to immunocytology to take advantage of the fact that the majority of hepatocytes were binuclear, providing us with a positive marker for their identification, even when the cell morphology was modified.

Expression of Bile Duct/Oval Cell Markers in Hepatocyte Primary Cultures
As for CK19, expression of A6 antigen and {alpha}6 integrin is considered a marker for bile duct/oval cells in the adult mouse liver [47, 48]. A6 and {alpha}6 integrin antibodies, on normal mouse liver sections, marked bile duct cells at the periportal zones and not the hepatocytes (supplemental online Fig. 1). On liver sections from mice subjected to the CDE diet, the two antibodies stained the proliferating oval cells that infiltrated the parenchyma [4].

In hepatocyte primary cultures, clusters of {alpha}6 integrin-positive cells, first seen on the 3rd day, progressively increased in number and size (Fig. 3A). CK19- and A6-positive cells appeared earlier and were already numerous by 3 days. Some of the positive cells were binuclear, proving that they are hepatocytes, and nearly all of the cells were positive at 8 days, when the transparent cells had become predominant (Fig. 3B). At the latter time, it was obvious that most of the cells coexpressed CK19 and A6. Quantitative analysis of these data revealed that on the 2nd day of culture, almost 50% of positive cells were binuclear and therefore hepatocytes (Fig. 3C). Further evidence that hepatocytes activated expression of the CK19 gene is provided in Figure 3D, which shows coexpression of albumin and CK19 in binuclear cells.


Figure 3
View larger version (79K):
[in this window]
[in a new window]
 
Figure 3. Expression of bile duct/oval cell markers in hepatocyte primary cultures. (A): Immunocytochemistry for {alpha}6 integrin on hepatocyte primary cultures at 3–8 days after inoculation. (B): Immunocytochemistry for CK19 and for A6 on hepatocyte primary cultures at 1–8 days after inoculation. (C): Activation of CK19 and A6 expression in hepatocyte primary cultures. Numbers were obtained from the experiment shown in (B). To calculate the percentage of CK19 or A6 expressing cells in the total population, 4 x 104 cells were examined for days 1 and 2, and 1 x 103 cells were examined for day 3. The percentage of binuclear cells in the total population was determined from 1 x 103 cells for each time point. The number of nuclei was counted in all (days 1 and 2) or in 1 x 103 (day 3) CK19- or A6-positive cells. (D): Double immunofluorescence for albumin and CK19 on a 3-day primary hepatocyte culture showing binuclear cells that express both proteins. Optical magnification, x50 (A, B), x100 (D).

 
In conclusion, the fact that hepatocytes can readily express a panel of bile duct/oval cell markers demonstrates the plasticity of their gene expression program. Consequently, it seems inappropriate to infer the origin of a liver cell line uniquely from its pattern of marker expression.

Cell Lines from Primary Cloning
Picking epithelial colonies from low density primary cultures gave rise to cell lines capable of indefinite growth. Only two requirements for progressive growth were noted: to permit dense colonies to form and to remain in place for 2–3 weeks, and to dissociate them completely for subculture. In four cell lines characterized, proliferation accelerated after 10–20 generations and finally the doubling time stabilized at approximately 24 hours (data not shown). As for primary cultures inoculated at high densities, cell morphology diversified with time: for example, fields of cells stuffed with vacuoles or with fat droplets were observed, or regions of cells with no apparent plasma membrane or, on the contrary, with very clearly delimited membranes giving a cobble stone appearance. Strikingly, the same morphological cell types appeared in independent cultures, often with the same timing.

To elucidate the origin and significance of this morphological diversification, we carried out primary cell cloning directly from the hepatocyte-enriched suspension [49] because the demonstration of the existence of different phenotypes among descendants of a single cell is the only reliable means to establish bi- or multipotentiality. In experiments with 100 cells per well in collagen-coated 48-well plates, cells reproducibly proliferated in 1/10th of the wells, whereas the plating efficiencies with 1 cell per well were extremely variable (<0.1%–3%; data not shown).

Three clonal cell lines (clones 3, 4, and 8) were derived from limiting dilution in 48-well plates and characterized more than 150 cell generations. In the progeny of the three lines, the same morphological diversity occurred with time, clearly reflecting cell plasticity. Cells of these lines are nontransformed because they were unable to grow in soft agar and failed to produce tumors in nude mice. Analysis of gene expression patterns was carried out to determine whether these cell lines are bipotential, as described for the bipotential mouse embryonic liver (BMEL) cell lines [8].

Expression of Bile Duct/Oval Cell and Hepatocyte Markers in the Clonal Cell Lines
Cell cultures of the three clones after approximately 30 doublings of the founder cell are presented in Figure 4A. At that time, the three bile duct/oval cell markers found in primary hepatocyte cultures were expressed, with A6 antigen in the majority of the cells, and localized to the membrane (Fig. 4B), and {alpha}6 integrin in discrete islands (Fig. 4C). Double immunofluorescent staining with anti-CK19 and anti-albumin revealed that cells of the three clones coexpressed the two proteins (Fig. 4D; data not shown). The expression of other bile duct/oval cell markers such as connexin 43, c-kit and {gamma}-glutamyl-transpeptidase [8] was detected in the clonal lines by RT-PCR (data not shown).


Figure 4
View larger version (92K):
[in this window]
[in a new window]
 
Figure 4. Expression of bile duct/oval cell and hepatocyte markers in the three clonal cell lines at approximately 30 generations. (A): Phase contrast photomicrographs of living cells of clones 3, 4, and 8. Even though the clone 4 field appears more homogeneous than the other two, we must point out that all three clonal cell lines were already morphologically heterogeneous at that time and that these fields were chosen to facilitate comparison with A6 staining in the fixed cells presented just below. (B): Immunofluorescence with A6 antibody. (C): Immunocytochemistry with {alpha}6 integrin antibody. (D): Double immunofluorescent labeling for albumin and CK19 on cells of clone 8. (E): Fluorescence and phase contrast photomicrographs of cell polarity assays on clone 4 (left) and clone 8 (middle) cultures overlaid with dilute Matrigel and incubated with fluorescein diacetate. Immunofluorescence for Cx32 on clone 3 cells is shown at the right. Optical magnification, x50 (A, C), x100 (B, D, E).

 
The potential of the cells to establish functional hepatocyte polarity was tested by Matrigel overlay and incubation with FDA (Fig. 4E; data not shown). Fluorescein accumulated in canalicular channels or in pockets in the three clones. Cx32, a component of gap junctions in hepatocytes [50], was detected only in clone 3 cells (Fig. 4E). Expression of hepatocyte functions in the clonal cell lines was investigated by RT-PCR during passages up to at least 100 generations. To highlight the subtle differences among the clones under conditions required to obtain expression, we classified our results in four groups (Fig. 5). In the first group, hepatocyte functions were expressed by all three lines from the earliest analysis (25 generations), including the fetal marker AFP, as shown for primary cultures. In the second group, functions were detected only after 30 generations (example: ADH and GS in clone 4). In the last two groups, activation of the functions required either aging of the culture (for example, OTC in clone 3) or induction by drugs (CPT-cAMP induced TO in clone 8, and glucagon induced TAT in clone 3); functions of these groups are normally expressed only late in liver development. The major point of these results is that all functions tested were expressed or could be elicited in every cell line.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Expression of fetal and adult hepatocyte markers in the three clonal cell lines. The gene expression pattern of clones 3, 4, and 8 was analyzed by reverse transcription-polymerase chain reaction. The box shadings correspond to groups of functions expressed early or late during culture history of the clones. Light gray boxes, transcripts present at 25 generations, the earliest time analyzed; medium-light gray boxes, transcripts detected after approximately 30 generations; medium-dark gray boxes, transcripts only observed after 10 days at confluence; dark gray boxes: glucagon or a cAMP analogue required for induction of transcripts. Abbreviations: ADH, alcohol dehydrogenase; AFP, {alpha}-fetoprotein; Alb, albumin; AldB, aldolase B; APO, alipoprotein; {alpha}1AT, {alpha}1 antitrypsin; G6Pase, glucose-6-phosphatase; GS, glutamine synthetase; OTC, ornithine transcarbamylase; PAH, phenylalanine hydroxylase; PEPCK, phosphoenolpyruvate carboxykinase; TAT, tyrosine aminotransferase; TO, tryptophane oxidase.

 
In conclusion, these cells derived from normal adult mouse liver have the potential to express both fetal and adult hepatocyte functions as well as bile duct/oval cell markers. We designate them bipotential adult mouse liver (BAML) clonal cell lines.

Karyotypes of the BAML Clonal Cell Lines
Karyotypes were determined at early passage after primary cloning and again after several months of serial passages (Fig. 6). Although the phenotypes of the three lines were strikingly similar, karyotypes at early and late times were quite different. Cells of clone 3 first had a hypotetraploid karyotype (mode = 78) and subsequently lost some chromosomes. Clones 4 and 8 both began with a bimodal karyotype with the major peak corresponding to diploid-like metaphases (64% for clone 4 and 46% for clone 8), and the other peak at around 80 chromosomes. However, after some 150 generations, the karyotype of clone 4 was exclusively hypotetraploid (mode = 70), whereas the majority of metaphases of clone 8 were diploid-like (mode = 40). These results suggest chromosome instability in tetraploid cells. In future work, it will be important for liver cell lines, as well as for lines from other tissues, to define nonrandom chromosomal changes that are found recurrently, such as those observed in embryonic stem cells [51, 52], and that could reflect adaptive genetic changes to culture conditions.


Figure 6
View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. Evolution of chromosome numbers in continuous cultures of the three clonal cell lines. Karyotypes were examined at approximately 25 generations and several months later, at approximately 150 generations. Histograms show chromosome numbers from 50 metaphase spreads. Abbreviation: g, generation.

 
Ability of the BAML Clonal Cell Lines to Participate in Liver Regeneration
To determine whether BAML cells are able to participate in liver regeneration and differentiate in vivo, the cells at approximately 25 generations were transduced with a lentiviral vector expressing GFP under control of the PGK promoter. These cells, which are nontumorigenic, were injected into the spleens of young Alb-uPA/SCID mice. A few weeks later, in livers of mice injected with cells of clones 4 and 8 (three of three and five of seven, respectively), numerous clusters of GFP expressing cells were seen (Fig. 7A–7C, 7G). The contribution to liver repopulation of the injected cells was quantified on total liver sections: up to 0.4% for clone 8 and up to 0.3% for clone 4 [29]. In contrast, no GFP-positive cells were found in livers of the five mice injected with cells of clone 3 (data not shown). The hypotetraploid clone 3 cells could be at a growth disadvantage in this system of competitive repopulation, where rare cells of the host liver that eliminate the deleterious Alb-uPA transgene proliferate to regenerate the liver [53]. Immunohistochemical analysis on adjacent liver sections with an antibody against Ki-67, which is expressed during all active phases of the cell cycle [54], showed that the GFP-positive cells proliferated in harmony with host hepatocytes (Fig. 7G, 7H).


Figure 7
View larger version (141K):
[in this window]
[in a new window]
 
Figure 7. Proliferation and differentiation as hepatocytes and bile ducts of cells from clones 4 and 8 during liver regeneration in albumin-uPA/severe combined immune deficiencient (Alb-uPA/SCID) transgenic mice. Shown are adjacent liver sections immunostained with different antibodies (corresponding sets: [A] and [D], [B] and [E], [C] and [F], and [G]–[I]). Liver sections were immunostained with anti-green fluorescent protein (GFP) (AC) and (G), anti-H2Dd (note presence of H2Dd-positive host mesenchymal cells) (D), anti-CK19 (E), anti-DPPIV (F), anti-Ki-67 (H), and anti-carbamoyl phosphate synthetase I (CPSI) (I). Liver sections are from mice injected with cells of clone 4-GFP (A, B, D, E, G, H, I) or with cells of clone 8-GFP (C, F). Scale bar = 100 µm.

 
Other laboratories have demonstrated that cells that repopulate the liver could be the products of fusion between injected cells and host hepatocytes [55, 56]. In the Alb-uPA model, this is unlikely, because fusion with hepatocytes harboring the toxic uPA transgene would not confer a selective advantage. The host mice are of H-2Dd haplotype, whereas the BAML cells are of H-2Db haplotype. Adjacent sections were immunostained with anti-GFP and anti-H-2Dd antibodies (Fig. 7A, 7D). The GFP-positive cells do not express H-2Dd, demonstrating that fusion between the injected and host cells did not occur. This pattern of expression was observed in all liver sections examined.

In rare cases, the GFP-positive cells had differentiated into cholangiocytes: a few bile ducts were observed in one mouse for clone 4 and in two mice for clone 8. Immunohistochemical analysis of adjacent sections confirmed that CK19 expressing bile ducts were indeed formed by GFP-positive BAML cells (Fig. 7B, 7E). The pattern of CK19 expression is indistinguishable between BAML and host-derived bile ducts (Fig. 7E, bottom). Figure 7 also illustrates the fact that GFP-positive BAML cells localized in liver parenchyma no longer express CK19.

Most of the GFP-positive cells were morphologically identical to host hepatocytes. Immunostaining with anti-DPPIV antibody revealed that the BAML cells were polarized as the neighboring host hepatocytes (Fig. 7C, 7F). In the adult mouse liver, carbamoyl phosphate synthetase I (CPSI) is involved in ammonia metabolism and is expressed by all hepatocytes except those nearest to the central veins [57]; BAML cells express CPSI when differentiated as hepatocytes (Fig. 7G, 7I).

These results demonstrate that BAML clonal cell lines 4 and 8, derived from liver of normal adult mice, are able to proliferate and differentiate as both hepatocytes and bile duct cells in vivo, responding normally to the host signals for growth and differentiation. Consequently, the BAML cells behave as liver stem cells.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
Many investigators have worked with rats or mice that have been treated to induce proliferation of oval cells [47, 58, 59] to isolate liver stem cell lines from adult liver. We demonstrate here that oval cell proliferation is not a prerequisite for the isolation at high frequency of bipotential liver cell lines. As in the case of BMEL cell lines isolated from embryonic liver of nontransgenic mice [8], we have been able to obtain BAML clonal cell lines from livers of untreated adult mice.

Using perfused liver cell suspensions enriched in hepatocytes plated at subconfluent density on collagen-coated dishes, we first defined a new combination of additives to Williams’ E medium that resulted in the reproducible emergence of continuously proliferating cultures. In such primary cultures, hepatocytes were highly motile, with tremendously plastic morphology and significant mitotic activity (supplemental online Videos 1, 2). Hepatocytes rapidly lost their polarity and other hepatocyte functions but activated expression of a panel of bile duct/oval cell markers. These modifications, which convert hepatocytes, at least in part, to the phenotype of oval cells, could be a consequence of the loss of tight intercellular and cell/extracellular matrix interactions. An early overlay of dilute Matrigel on these cultures reduced, as expected, both hepatocyte dedifferentiation and cell proliferation [36].

Nests of transparent epithelial cells appeared after 5 days and were numerous by 8 days, when karyotype analysis revealed that the fraction of diploid metaphases was on the rise. This implies that most of these cells were diploid and therefore did not derive from the numerous binuclear hepatocytes, although they could originate from proliferation of mononuclear diploid hepatocytes, the likely candidates being the cells that activated expression of bile duct/oval cell markers. Indeed, Block et al. [36] have reported that rat hepatocytes are capable of clonal growth. The transparent cells could also originate from rare progenitor/oval cells present in normal liver [60, 61] that could copurify with hepatocytes if attached to them. Our data do not permit exclusion of either possibility.

The transparent epithelial cells clearly gave rise to the continuously proliferating cultures, for which bile duct/oval cell marker expression was detected in almost every cell. A large panel of hepatocyte markers was also revealed (data not shown), with additional functions activated in aged confluent cultures. Aside from the question of the origin of these cells, the latter results posed the question of their bipotentiality, a question resolvable only by study of the progeny of single cells.

Cells of three clones, isolated by limiting dilution of the hepatocyte-enriched suspension, divide continuously, are not transformed, and can remain at confluence for long periods without signs of overgrowth or death. The same bile duct/oval cell and hepatocyte markers found in the cell lines derived from subconfluent primary cultures and from colonies were also revealed in the progeny of the three clones that we can legitimately call BAML cell lines. More importantly, these experiments prove the existence in normal young adult C57BL/6 mouse liver of a significant pool of cells that can give rise to bipotential progeny in culture.

Bipotentiality of the BAML cells in vivo was demonstrated by the ability of the clonal lines to contribute to formation of both bile ducts and hepatocytes upon transplantation into mice of the Alb-uPA/SCID model of liver regeneration. Under these circumstances, BAML cells proliferated in harmony with the host liver cells and responded appropriately to host differentiation signals. Comparison of repopulation by BAML and BMEL cells revealed that the adult-derived lines were less efficient than the embryonic cells and that they contributed preferentially to the hepatocyte population, as described for adult rat hepatocytes that were freshly isolated or after short-term culture [62, 63]. The two types of bipotential liver cell lines, BMEL and BAML, will require further analysis to decipher the mechanisms underlying these differences.

Recent work has demonstrated the transdifferentiation of rat hepatocytes into biliary cells in vivo when bile duct regeneration is induced [64], as well as in vitro upon the formation of organoids and spheroids [65, 66]. We have shown that mouse hepatocytes in culture acquire the expression of bile duct/oval cells markers. These demonstrations of the plasticity of hepatocyte differentiation, along with the extensive documentation of oval cell differentiation into both hepatocytes and bile duct cells, lead us to suggest that there is not a unique source of bipotential cells in the liver. Indeed, Michalopoulos et al. [64] refer to cholangiocytes and hepatocytes as facultative stem cells for each other.

In conclusion, cells able to differentiate either into hepatocytes or bile ducts are abundant in the liver of adult normal mice. However, available information does not permit us to affirm that this bipotentiality is intrinsic to the progenitor cell of each line, for it could be acquired as a consequence of cell culture [67]. In the present work, it appears likely that mononuclear hepatocytes are the progenitors of one or more of the BAML cell lines. It is also probable that oval cells, more abundant in appropriately treated mice, could also give rise to the same types of cell lines. The protocol to establish BAML cell lines from single cells of the normal liver is robust and can be applied to transgenic and mutant mice. Finally, it will be critical to determine whether such cells exist in human liver for possible applications in liver cell therapy.


    DISCLOSURES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
We thank Laurent Rénia (INSERM, Institut Cochin, Paris, France), Denise Glaise and Christiane Guguen-Guillouzo (INSERM, Université de Rennes, France) for stimulating discussions and helpful advice on liver perfusion. We are very grateful to Céline Mulet and Patricia Flamant for technical assistance. We thank Emmanuelle Perret and Mathieu Marchand for help in time-lapse image acquisition and treatment (Plate-Forme d’ Imagerie Dynamique, Institut Pasteur). This work was supported by the Action Thématique Concertée Biotherapies Program of the INSERM, by the Ministère de l’Education Nationale, de l’Enseignement Supérieur et de la Recherche, and by the Grand Programme Horizontal 7 (Stem Cells) of the Institut Pasteur, which also supported H.S-M. C.F-D. and T.I.-S. contributed equally to this work. H.S.-M. is currently affiliated with Unité des Cytokines et Développement Lymphoide, Institut Pasteur, Paris.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 

  1. Zegers MM, Hoekstra D. Mechanisms and functional features of polarized membrane traffic in epithelial and hepatic cells. Biochem J 1998;336:257–269.[Medline]

  2. Nadal C, Zajdela F. Somatic polyploid cells in rat liver. I. The role of binuclear cells in the formation of the polyploid cells. Exp Cell Res 1966;42:99–116.[Medline]

  3. Overturf K, al-Dhalimy M, Ou CN et al. Serial transplantation reveals the stem-cell-like regenerative potential of adult mouse hepatocytes. Am J Pathol 1997;151:1273–1280.[Abstract]

  4. Akhurst B, Croager EJ, Farley-Roche CA et al. A modified choline-deficient, ethionine-supplemented diet protocol effectively induces oval cells in mouse liver. Hepatology 2001;34:519–522.[CrossRef][Medline]

  5. Kofman AV, Morgan G, Kirschenbaum A et al. Dose-and time-dependent oval cell reaction in acetaminophen-induced murine liver injury. Hepatology 2005;41:1252–1261.[CrossRef][Medline]

  6. Paku S, Nagy P, Kopper L et al. 2-Acetylaminofluorene dose-dependent differentiation of rat oval cells into hepatocytes: Confocal and electron microscopic studies. Hepatology 2004;39:1353–1361.[CrossRef][Medline]

  7. Petersen BE, Zajac VF, Michalopoulos GK. Hepatic oval cell activation in response to injury following chemically induced periportal or pericentral damage in rats. Hepatology 1998;27:1030–1038.[CrossRef][Medline]

  8. Strick-Marchand H, Weiss MC. Inducible differentiation and morphogenesis of bipotential liver cell lines from wild-type mouse embryos. Hepatology 2002;36:794–804.[Medline]

  9. Berthiaume F, Moghe PV, Toner M et al. Effect of extracellular matrix topology on cell structure, function, and physiological responsiveness: Hepatocytes cultured in a sandwich configuration. FASEB J 1996;10:1471–1484.[Abstract]

  10. Christoffersen T, Thoresen GH, Dajani OF et al. Mechanisms of hepatocyte growth regulation by hormones and growth factors. In: Berry MN, Edwards AM, eds. The Hepatocyte Review. Dordrecht: Kluwer Academic Publishers, 2000;209–246.

  11. Edwards AM, Michalopoulos GK. Conditions for growth of hepatocytes in culture. In: Berry MN, Edwards AM, eds. The Hepatocyte Review. Dordrecht: Kluwer Academic Publishers, 2000;73–96.

  12. Li AP. Human hepatocytes as an experimental system for the evaluation of xenobiotics. In: Berry MN, Edwards AM, eds. The Hepatocyte Review. Dordrecht: Kluwer Academic Publishers, 2000;391–410.

  13. Smith MD, Grant MH, Cousins RB et al. A review of bioartificial liver development from an artificial organ engineering perspective. In: Berry MN, Edwards AM, eds. The Hepatocyte Review. Dordrecht: Kluwer Academic Publishers, 2000;521–541.

  14. Davies CS, Suhrbier AS, Winger LA et al. Improved techniques for the culture of the liver stages of Plasmodium berghei and their relevance to the study of causal prophylactic drugs. Acta Leiden 1989;58:97–113.[Medline]

  15. Moshage H, Yap SH. Primary cultures of human hepatocytes: A unique system for studies in toxicology, virology, parasitology and liver pathophysiology in man. J Hepatol 1992;15:404–413.[CrossRef][Medline]

  16. Klocke R, Gomez-Lechon MJ, Ehrhardt A et al. Establishment and characterization of immortal hepatocytes derived from various transgenic mouse lines. Biochem Biophys Res Commun 2002;294:864–871.[CrossRef][Medline]

  17. Mikula M, Fuchs E, Huber H et al. Immortalized p19ARF null hepatocytes restore liver injury and generate hepatic progenitors after transplantation. Hepatology 2004;39:628–634.[CrossRef][Medline]

  18. Sacco MG, Amicone L, Cato EM et al. Cell-based assay for the detection of chemically induced cellular stress by immortalized untransformed transgenic hepatocytes. BMC Biotechnol 2004;4:5.[CrossRef][Medline]

  19. Wu JC, Merlino G, Fausto N. Establishment and characterization of differentiated, nontransformed hepatocyte cell lines derived from mice transgenic for transforming growth factor alpha. Proc Natl Acad Sci U S A 1994;91:674–678.[Abstract/Free Full Text]

  20. Tsao MS, Smith JD, Nelson KG et al. A diploid epithelial cell line from normal adult rat liver with phenotypic properties of ‘oval’ cells. Exp Cell Res 1984;154:38–52.[CrossRef][Medline]

  21. Coleman WB, McCullough KD, Esch GL et al. Evaluation of the differentiation potential of WB-F344 rat liver epithelial stem-like cells in vivo. Differentiation to hepatocytes after transplantation into dipeptidylpeptidase-IV-deficient rat liver. Am J Pathol 1997;151:353–359.[Abstract]

  22. Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol 1976;13:29–83.[Medline]

  23. Kreamer BL, Staecker JL, Sawada N et al. Use of a low-speed, iso-density percoll centrifugation method to increase the viability of isolated rat hepatocyte preparations. In Vitro Cell Dev Biol 1986;22:201–211.[Medline]

  24. Sidhu JS, Liu F, Omiecinski CJ. Phenobarbital responsiveness as a uniquely sensitive indicator of hepatocyte differentiation status: Requirement of dexamethasone and extracellular matrix in establishing the functional integrity of cultured primary rat hepatocytes. Exp Cell Res 2004;292:252–264.[CrossRef][Medline]

  25. Ihrke G, Neufeld EB, Meads T et al. WIF-B cells: An in vitro model for studies of hepatocyte polarity. J Cell Biol 1993;123:1761–1775.[Abstract/Free Full Text]

  26. Sirven A, Ravet E, Charneau P et al. Enhanced transgene expression in cord blood CD34(+)-derived hematopoietic cells, including developing T cells and NOD/SCID mouse repopulating cells, following transduction with modified trip lentiviral vectors. Mol Ther 2001;3:438–448.[CrossRef][Medline]

  27. Zennou V, Petit C, Guetard D et al. HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 2000;101:173–185.[CrossRef][Medline]

  28. Spagnoli FM, Amicone L, Tripodi M et al. Identification of a bipotential precursor cell in hepatic cell lines derived from transgenic mice expressing cyto-Met in the liver. J Cell Biol 1998;143:1101–1112.[Abstract/Free Full Text]

  29. Strick-Marchand H, Morosan S, Charneau P et al. Bipotential mouse embryonic liver stem cell lines contribute to liver regeneration and differentiate as bile ducts and hepatocytes. Proc Natl Acad Sci U S A 2004;101:8360–8365.[Abstract/Free Full Text]

  30. Zito MA, Koennecke LA, McAuliffe MJ et al. Depletion of systemic macrophages by liposome-encapsulated clodronate attenuates striatal macrophage invasion and neurodegeneration following local endotoxin infusion in gerbils. Brain Res 2001;892:13–26.[CrossRef][Medline]

  31. Torres-Padilla ME, Fougere-Deschatrette C, Weiss MC. Expression of HNF4alpha isoforms in mouse liver development is regulated by sequential promoter usage and constitutive 3' end splicing. Mech Dev 2001;109:183–193.[CrossRef][Medline]

  32. Inoue C, Yamamoto H, Nakamura T et al. Nicotinamide prolongs survival of primary cultured hepatocytes without involving loss of hepatocyte-specific functions. J Biol Chem 1989;264:4747–4750.[Abstract/Free Full Text]

  33. Mitaka T, Sattler CA, Sattler GL et al. Multiple cell cycles occur in rat hepatocytes cultured in the presence of nicotinamide and epidermal growth factor. Hepatology 1991;13:21–30.[CrossRef][Medline]

  34. Tateno C, Yoshizato K. Long-term cultivation of adult rat hepatocytes that undergo multiple cell divisions and express normal parenchymal phenotypes. Am J Pathol 1996;148:383–392.[Abstract]

  35. Guidotti JE, Bregerie O, Robert A et al. Liver cell polyploidization: A pivotal role for binuclear hepatocytes. J Biol Chem 2003;278:19095–19101.[Abstract/Free Full Text]

  36. Block GD, Locker J, Bowen WC et al. Population expansion, clonal growth, and specific differentiation patterns in primary cultures of hepatocytes induced by HGF/SF, EGF and TGF alpha in a chemically defined (HGM) medium. J Cell Biol 1996;132:1133–1149.[Abstract/Free Full Text]

  37. Hamilton GA, Jolley SL, Gilbert D et al. Regulation of cell morphology and cytochrome P450 expression in human hepatocytes by extracellular matrix and cell-cell interactions. Cell Tissue Res 2001;306:85–99.[CrossRef][Medline]

  38. Musat AI, Sattler CA, Sattler GL et al. Reestablishment of cell polarity of rat hepatocytes in primary culture. Hepatology 1993;18:198–205.[CrossRef][Medline]

  39. Tournier-Thurneyssen I, Feldmann G, Bernuau D. Cellular analysis of the kinetics of alpha-fetoprotein and nuclear oncogene activation in primary cultures of adult rat hepatocytes stimulated by epidermal growth factor. Biol Cell 1992;75:61–68.[CrossRef][Medline]

  40. van Eyken P, Sciot R, van Damme B et al. Keratin immunohistochemistry in normal human liver. Cytokeratin pattern of hepatocytes, bile ducts and acinar gradient. Virchows Arch A Pathol Anat Histopathol 1987;412:63–72.[CrossRef][Medline]

  41. Blaheta RA, Kronenberger B, Woitaschek D et al. Dedifferentiation of human hepatocytes by extracellular matrix proteins in vitro: Quantitative and qualitative investigation of cytokeratin 7, 8, 18, 19 and vimentin filaments. J Hepatol 1998;28:677–690.[CrossRef][Medline]

  42. Van Eyken P, Sciot R, Desmet VJ. A cytokeratin immunohistochemical study of cholestatic liver disease: Evidence that hepatocytes can express ‘bile duct-type’ cytokeratins. Histopathology 1989;15:125–135.[Medline]

  43. Talamini MA, Kappus B, Hubbard A. Repolarization of hepatocytes in culture. Hepatology 1997;25:167–172.[Medline]

  44. Ezzell RM, Toner M, Hendricks K et al. Effect of collagen gel configuration on the cytoskeleton in cultured rat hepatocytes. Exp Cell Res 1993;208:442–452.[CrossRef][Medline]

  45. Feracci H, Connolly TP, Margolis RN et al. The establishment of hepatocyte cell surface polarity during fetal liver development. Dev Biol 1987;123:73–84.[CrossRef][Medline]

  46. Ben-Ze’ev A, Robinson GS, Bucher NL et al. Cell-cell and cell-matrix interactions differentially regulate the expression of hepatic and cytoskeletal genes in primary cultures of rat hepatocytes. Proc Natl Acad Sci U S A 1988;85:2161–2165.[Abstract/Free Full Text]

  47. Engelhardt NV, Factor VM, Yasova AK et al. Common antigens of mouse oval and biliary epithelial cells. Expression on newly formed hepatocytes. Differentiation 1990;45:29–37.[Medline]

  48. Shiojiri N, Sugiyama Y. Immunolocalization of extracellular matrix components and integrins during mouse liver development. Hepatology 2004;40:346–355.[CrossRef][Medline]

  49. Grisham JW, Thal SB, Nagel A. Gene Expression and Carcinogenesis in Cultured Liver. In: Gerschenson LE, Thompson EB, eds. New York: Academic Press, 1974;1–23.

  50. Kojima T, Kokai Y, Chiba H et al. Cx32 but not Cx26 is associated with tight junctions in primary cultures of rat hepatocytes. Exp Cell Res 2001;263:193–201.[CrossRef][Medline]

  51. Buzzard JJ, Gough NM, Crook JM et al. Karyotype of human ES cells during extended culture. Nat Biotechnol 2004;22:381–382 author reply 382.[CrossRef][Medline]

  52. Draper JS, Smith K, Gokhale P et al. Recurrent gain of chromosomes 17q and 12 in cultured human embryonic stem cells. Nat Biotechnol 2004;22:53–54.[CrossRef][Medline]

  53. Sandgren EP, Palmiter RD, Heckel JL et al. Complete hepatic regeneration after somatic deletion of an albumin-plasminogen activator transgene. Cell 1991;66:245–256.[CrossRef][Medline]

  54. Scholzen T, Gerdes J. The Ki-67 protein: From the known and the unknown. J Cell Physiol 2000;182:311–322.[CrossRef][Medline]

  55. Vassilopoulos G, Russell DW. Cell fusion: An alternative to stem cell plasticity and its therapeutic implications. Curr Opin Genet Dev 2003;13:480–485.[CrossRef][Medline]

  56. Wang X, Willenbring H, Akkari Y et al. Cell fusion is the principal source of bone-marrow-derived hepatocytes. Nature 2003;422:897–901.[CrossRef][Medline]

  57. Jungermann K, Katz N. Functional hepatocellular heterogeneity. Hepatology 1982;2:385–395.[Medline]

  58. Brooling JT, Campbell JS, Mitchell C et al. Differential regulation of rodent hepatocyte and oval cell proliferation by interferon gamma. Hepatology 2005;41:906–915.[CrossRef][Medline]

  59. Shafritz DA, Dabeva MD. Liver stem cells and model systems for liver repopulation. J Hepatol 2002;36:552–564.[CrossRef][Medline]

  60. Azuma H, Hirose T, Fujii H et al. Enrichment of hepatic progenitor cells from adult mouse liver. Hepatology 2003;37:1385–1394.[CrossRef][Medline]

  61. Suzuki A, Zheng Y, Kondo R et al. Flow-cytometric separation and enrichment of hepatic progenitor cells in the developing mouse liver. Hepatology 2000;32:1230–1239.[CrossRef][Medline]

  62. Oertel M, Rosencrantz R, Chen YQ et al. Repopulation of rat liver by fetal hepatoblasts and adult hepatocytes transduced ex vivo with lentiviral vectors. Hepatology 2003;37:994–1005.[CrossRef][Medline]

  63. Sandhu JS, Petkov PM, Dabeva MD et al. Stem cell properties and repopulation of the rat liver by fetal liver epithelial progenitor cells. Am J Pathol 2001;159:1323–1334.[Abstract/Free Full Text]

  64. Michalopoulos GK, Barua L, Bowen WC. Transdifferentiation of rat hepatocytes into biliary cells after bile duct ligation and toxic biliary injury. Hepatology 2005;41:535–544.[CrossRef][Medline]

  65. Michalopoulos GK, Bowen WC, Mule K et al. Hepatocytes undergo phenotypic transformation to biliary epithelium in organoid cultures. Hepatology 2002;36:278–283.[CrossRef][Medline]

  66. Nishikawa Y, Doi Y, Watanabe H et al. Transdifferentiation of mature rat hepatocytes into bile duct-like cells in vitro. Am J Pathol 2005;166:1077–1088.[Abstract/Free Full Text]

  67. Joseph NM, Morrison SJ. Toward an understanding of the physiological function of mammalian stem cells. Dev Cell 2005;9:173–183.[CrossRef][Medline]




This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. Kuver, C. E. Savard, S. K. Lee, W. G. Haigh, and S. P. Lee
Murine gallbladder epithelial cells can differentiate into hepatocyte-like cells in vitro
Am J Physiol Gastrointest Liver Physiol, November 1, 2007; 293(5): G944 - G955.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
C. Duret, S. Gerbal-Chaloin, J. Ramos, J.-M. Fabre, E. Jacquet, F. Navarro, P. Blanc, A. Sa-Cunha, P. Maurel, and M. Daujat-Chavanieu
Isolation, Characterization, and Differentiation to Hepatocyte-Like Cells of Nonparenchymal Epithelial Cells from Adult Human Liver
Stem Cells, July 1, 2007; 25(7): 1779 - 1790.